ID: 1030786985

View in Genome Browser
Species Human (GRCh38)
Location 7:113674562-113674584
Sequence TTTCTAAGTTACCCTGTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030786983_1030786985 5 Left 1030786983 7:113674534-113674556 CCTCCAAAACTGTAAGAAAAAAA No data
Right 1030786985 7:113674562-113674584 TTTCTAAGTTACCCTGTATCAGG No data
1030786982_1030786985 26 Left 1030786982 7:113674513-113674535 CCTTGATATTGGACTTTACAGCC No data
Right 1030786985 7:113674562-113674584 TTTCTAAGTTACCCTGTATCAGG No data
1030786984_1030786985 2 Left 1030786984 7:113674537-113674559 CCAAAACTGTAAGAAAAAAATTG No data
Right 1030786985 7:113674562-113674584 TTTCTAAGTTACCCTGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030786985 Original CRISPR TTTCTAAGTTACCCTGTATC AGG Intergenic
No off target data available for this crispr