ID: 1030791586

View in Genome Browser
Species Human (GRCh38)
Location 7:113736296-113736318
Sequence GAGGTGAAAATTCAGTTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030791584_1030791586 21 Left 1030791584 7:113736252-113736274 CCATCTGTTTGGGGTTCATTTTG No data
Right 1030791586 7:113736296-113736318 GAGGTGAAAATTCAGTTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030791586 Original CRISPR GAGGTGAAAATTCAGTTCAT TGG Intergenic
No off target data available for this crispr