ID: 1030798792

View in Genome Browser
Species Human (GRCh38)
Location 7:113823676-113823698
Sequence TCTCATCTATAGAAGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030798792_1030798794 15 Left 1030798792 7:113823676-113823698 CCCTGCAGCTTCTATAGATGAGA No data
Right 1030798794 7:113823714-113823736 TGATTCCTTCCATAATTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030798792 Original CRISPR TCTCATCTATAGAAGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr