ID: 1030798794

View in Genome Browser
Species Human (GRCh38)
Location 7:113823714-113823736
Sequence TGATTCCTTCCATAATTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030798793_1030798794 14 Left 1030798793 7:113823677-113823699 CCTGCAGCTTCTATAGATGAGAT No data
Right 1030798794 7:113823714-113823736 TGATTCCTTCCATAATTACTTGG No data
1030798792_1030798794 15 Left 1030798792 7:113823676-113823698 CCCTGCAGCTTCTATAGATGAGA No data
Right 1030798794 7:113823714-113823736 TGATTCCTTCCATAATTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030798794 Original CRISPR TGATTCCTTCCATAATTACT TGG Intergenic
No off target data available for this crispr