ID: 1030803855

View in Genome Browser
Species Human (GRCh38)
Location 7:113889053-113889075
Sequence CTGTATATGGAGGTGAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030803849_1030803855 9 Left 1030803849 7:113889021-113889043 CCTACCTCTATAAAATCTAAATT 0: 1
1: 0
2: 3
3: 56
4: 824
Right 1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG No data
1030803850_1030803855 5 Left 1030803850 7:113889025-113889047 CCTCTATAAAATCTAAATTAATA 0: 1
1: 0
2: 3
3: 70
4: 674
Right 1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG No data
1030803848_1030803855 10 Left 1030803848 7:113889020-113889042 CCCTACCTCTATAAAATCTAAAT 0: 1
1: 0
2: 4
3: 61
4: 758
Right 1030803855 7:113889053-113889075 CTGTATATGGAGGTGAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030803855 Original CRISPR CTGTATATGGAGGTGAAGAT GGG Intronic
No off target data available for this crispr