ID: 1030807749

View in Genome Browser
Species Human (GRCh38)
Location 7:113937479-113937501
Sequence AGCTGCTTAGAGAAGTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 472
Summary {0: 1, 1: 2, 2: 71, 3: 135, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030807749_1030807753 3 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807753 7:113937505-113937527 CCTGCCAACTCAAGTGTCCATGG 0: 17
1: 39
2: 97
3: 134
4: 304
1030807749_1030807754 6 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807754 7:113937508-113937530 GCCAACTCAAGTGTCCATGGTGG 0: 16
1: 48
2: 91
3: 103
4: 296
1030807749_1030807758 14 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807758 7:113937516-113937538 AAGTGTCCATGGTGGTCAAGGGG 0: 11
1: 8
2: 50
3: 75
4: 273
1030807749_1030807756 12 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807756 7:113937514-113937536 TCAAGTGTCCATGGTGGTCAAGG 0: 9
1: 24
2: 64
3: 108
4: 599
1030807749_1030807757 13 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807757 7:113937515-113937537 CAAGTGTCCATGGTGGTCAAGGG 0: 10
1: 10
2: 44
3: 78
4: 216
1030807749_1030807760 29 Left 1030807749 7:113937479-113937501 CCCTAAGACTTCTCTAAGCAGCT 0: 1
1: 2
2: 71
3: 135
4: 263
Right 1030807760 7:113937531-113937553 TCAAGGGGTGTCCTCTTTCCAGG 0: 1
1: 0
2: 4
3: 20
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030807749 Original CRISPR AGCTGCTTAGAGAAGTCTTA GGG (reversed) Intronic
900847864 1:5118075-5118097 ATCTGATTAGAGAGTTCTTAAGG - Intergenic
902398740 1:16146067-16146089 GGCTGCTGAGAGAAGTCTAGAGG + Intronic
902443632 1:16447765-16447787 AGCTGGTTAGAGATGCCTTGCGG + Intronic
908634727 1:66150234-66150256 AGCTGATTCCAGAATTCTTATGG - Intronic
908667527 1:66509803-66509825 AGCTGCTTAGAGAAGTGGGAGGG + Intergenic
908935837 1:69374354-69374376 AGCTACTTAGGGAAGTGGTAGGG - Intergenic
909024535 1:70467691-70467713 AGCTGCTTAGAGAAGTGATGGGG + Intergenic
909049773 1:70753551-70753573 AGCTGCTTAGAGAAGTGGTGGGG - Intergenic
909673150 1:78211471-78211493 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
911032898 1:93508851-93508873 AGGTACTTAGAGAAGTGTTTAGG + Intronic
911496347 1:98636543-98636565 AGCTGCACAGAGAAGTATTAGGG + Intergenic
912176619 1:107165909-107165931 AACTGTTTAGAGAACACTTAGGG - Intronic
913349495 1:117842279-117842301 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
915053442 1:153102767-153102789 AGCTGCTTAGGGAAGTGACAGGG + Intronic
915852486 1:159340517-159340539 AGCTTTTTAAAGAAGTCTGAAGG - Intergenic
917567621 1:176229468-176229490 AGCTGCTTAGAGAAGGGGTAGGG + Intergenic
917895587 1:179484225-179484247 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
918980070 1:191546071-191546093 AGCAGTTTAGAGATTTCTTAAGG + Intergenic
919207547 1:194437095-194437117 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
920003147 1:202812768-202812790 AGCTGCTTAGAGAAGCTGTGAGG + Intergenic
920624744 1:207586063-207586085 AGCTTCTTACAGAAGGCTGATGG + Intronic
921104103 1:211959119-211959141 GGCTGCTTAGAGAAGTGTTAGGG + Intronic
921776883 1:219111813-219111835 AGCTGCTTAGTGAAGTGATGGGG + Intergenic
921800816 1:219399948-219399970 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
923558135 1:235017985-235018007 AGCTCCTCAGAGAAGTCTTCTGG + Intergenic
923855204 1:237838719-237838741 AGCTGCTTAGAGAAGTGGTAAGG + Intergenic
1063819535 10:9819099-9819121 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1065742279 10:28807840-28807862 AGCTGATTAGAAACCTCTTAGGG - Intergenic
1068261893 10:54594201-54594223 AGCTACTTAGTGAAGTGGTAGGG + Intronic
1068463034 10:57351563-57351585 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1069129153 10:64677434-64677456 AGCTTTTTAGATAAGTCTTTAGG + Intergenic
1069334175 10:67328484-67328506 AGCTGCTTAGAGAAGGGTTAGGG - Intronic
1070526608 10:77300894-77300916 AGCTGCTCACAGAAATCCTAGGG + Intronic
1071454634 10:85836577-85836599 AGCTGATTAGAGAAGTGGTGGGG + Intronic
1071736139 10:88303194-88303216 AGCTGCTTAGAGAAGAGGTAGGG + Intronic
1072493981 10:95936237-95936259 AGCTGTTTAGAGAAGTTGTTTGG + Intronic
1072509810 10:96109186-96109208 AGTTTCTTAGAACAGTCTTAAGG + Intergenic
1072681064 10:97507098-97507120 AGCTGCTGAGGAAAGTGTTATGG - Intronic
1073772764 10:106753333-106753355 GGTGGCTTAGAGAAGTCTTAGGG + Intronic
1073991480 10:109267044-109267066 AGATGCTCAGAGAATTCTGAAGG + Intergenic
1074556171 10:114492389-114492411 AGCTGCATAGAGGAGACTTAGGG - Intronic
1075571562 10:123550227-123550249 AGATGCTTGGAAAAGTCTTCTGG + Intergenic
1079451521 11:20603123-20603145 AGCTGTCAGGAGAAGTCTTAGGG - Intronic
1080224915 11:29949835-29949857 ACCTGCTTAGAGAAGTGGTAGGG + Intergenic
1080256331 11:30295110-30295132 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
1080516637 11:33028524-33028546 ACCTGCTTAGAAAAATATTATGG + Intronic
1080861561 11:36154523-36154545 AGAGGTTTAGAGAAGTCGTAGGG + Intronic
1080991862 11:37546135-37546157 TGCTGCTTAGAAAATTCTTAAGG + Intergenic
1081083159 11:38768389-38768411 AGTTGCTTAGAGAAGTCATAGGG + Intergenic
1081380725 11:42411393-42411415 AGCTGCTTATATATGTCTTTGGG - Intergenic
1082075357 11:47972025-47972047 ACCTGCTTAATGAAGTCTCAGGG + Intergenic
1082193487 11:49274248-49274270 AGCTGCTTGGAGAAGTGTCAGGG - Intergenic
1082630406 11:55535105-55535127 AGGTATTTAGAAAAGTCTTAGGG + Intergenic
1082665438 11:55970810-55970832 AGATGCTTAGACAAGTGGTAGGG + Intergenic
1085815044 11:79728230-79728252 AGCTGCTTAGAGAACTCATAGGG - Intergenic
1085856537 11:80181885-80181907 AGCTACTCAGAGAAGTGGTAGGG - Intergenic
1087148771 11:94838930-94838952 GGCTGGATAGTGAAGTCTTAGGG + Intronic
1087309358 11:96521883-96521905 ATCTGCTGAGAGAAGTGGTAGGG - Intergenic
1087377900 11:97367541-97367563 AGATGCTTAGAGAAGTGGTAGGG + Intergenic
1087561580 11:99796839-99796861 AGCTGCTTAGAGATGTAGTAGGG - Intronic
1087619822 11:100528612-100528634 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1088596107 11:111441523-111441545 AGTTCCTTAGAGATGCCTTACGG + Intronic
1088806628 11:113358711-113358733 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1089065401 11:115658882-115658904 AGCTACTTAAAGAATTCTCAGGG - Intergenic
1090105693 11:123851949-123851971 AGCTTCTTAGAGAGGTGGTAGGG - Intergenic
1090600366 11:128363635-128363657 AGCTTCTTAGAGAAGGATTTTGG - Intergenic
1090684430 11:129100090-129100112 AGCTTCTTAGAGAAGTGGTAGGG + Intronic
1090740344 11:129654257-129654279 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1091694690 12:2620254-2620276 AGGTGCTTAGAGCAGTATTAGGG - Intronic
1093148832 12:15598423-15598445 AACTGGTTAGAGTAGCCTTACGG - Intergenic
1093218998 12:16396536-16396558 AGCTGTTTGGAGGAGTCTTTAGG - Intronic
1093490618 12:19700541-19700563 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
1095542811 12:43330346-43330368 AGCTGCTTAAAGAAGTAATAGGG - Intergenic
1096291955 12:50351178-50351200 AGCTGCTCAGAGAAGGTTAAGGG + Exonic
1097640599 12:62176806-62176828 TGCTGGTTAGAGAATTCTTTTGG - Intronic
1097826927 12:64183701-64183723 AGCTGGTAAGAAAATTCTTAGGG - Intergenic
1098678493 12:73321232-73321254 AGCTGCTTATAGAAGTGATAAGG + Intergenic
1099414702 12:82371790-82371812 AGCTGCTCAGGGAAGTCAGAAGG + Intronic
1099732863 12:86526808-86526830 AGCTGCTTAGAGAAGTTGTAGGG - Intronic
1100231447 12:92612369-92612391 AGCTGTTTCCAGAAGTGTTAGGG - Intergenic
1100290638 12:93211125-93211147 AGCTTTCTAGAGAAGTCCTAAGG + Intergenic
1101471335 12:104999678-104999700 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1105396862 13:20044223-20044245 AGCTGCTTAAAGAAGTTGTAGGG - Intronic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1109275273 13:60297217-60297239 AGCAAGTTAGACAAGTCTTATGG - Intergenic
1109326211 13:60870410-60870432 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
1109667138 13:65553778-65553800 AGCTGCTTAAAGAAGTGGTAGGG - Intergenic
1111113706 13:83749419-83749441 AGCTGCTAAGAGAAGTGGTGGGG + Intergenic
1111231841 13:85354281-85354303 AGCTCCTTAGACAAGTAGTAGGG + Intergenic
1112371463 13:98797388-98797410 AGCTGCTTAAGGAAGTTTTCAGG - Exonic
1113617601 13:111692123-111692145 AGCTGTTTAGAGAATTTTGATGG + Intergenic
1113623131 13:111777383-111777405 AGCTGTTTAGAGAATTTTGATGG + Intergenic
1115811662 14:37115659-37115681 AGCTGCTGAGAAAAGAATTAAGG + Intronic
1115883370 14:37945389-37945411 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
1116243481 14:42378740-42378762 AGTTGCTTAGAGAAGTGGTAGGG + Intergenic
1116282747 14:42929201-42929223 AGTTGGTTAGAGAAGTGGTAGGG - Intergenic
1116336596 14:43665497-43665519 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1116440618 14:44947489-44947511 AGCTGCTTAGAGTAGACAAAAGG + Intronic
1116577228 14:46589141-46589163 ATTTGCTTAGACATGTCTTATGG + Intergenic
1117033377 14:51699669-51699691 ATGTGCTTTGAGAATTCTTAAGG + Intronic
1117638663 14:57774388-57774410 AGCTTCTTAGAGAAGTGGTAGGG + Intronic
1118165959 14:63336643-63336665 AGCTTTTTGGAGAAGTCTTTAGG - Intergenic
1118416077 14:65538182-65538204 AGCTGCTTCGAGAAGTGGTAAGG - Intronic
1118540037 14:66813593-66813615 AGTTACTTAGGGAAGTCTTAAGG + Intronic
1118646639 14:67846911-67846933 AGGTGCTTAGAGAGGTGGTAGGG - Intronic
1119342965 14:73896362-73896384 AGCTGTTTTGAGAAGCCTTCGGG + Exonic
1120723968 14:87917023-87917045 AGCTACTCAGAGAAGTGGTAGGG - Intronic
1123875783 15:24622365-24622387 AGCTGTTTAGAGAGGTAATAAGG - Intergenic
1124077679 15:26461584-26461606 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1124502120 15:30237714-30237736 AGCTTTTTGGAGAAGTCTTTGGG + Intergenic
1124741444 15:32300938-32300960 AGCTTTTTGGAGAAGTCTTTGGG - Intergenic
1124865381 15:33485631-33485653 AGCTGCCTAGAGAAGAATAATGG + Intronic
1125239492 15:37557972-37557994 AGCTGCTTAGAGAAGTGGAAGGG + Intergenic
1126168763 15:45676432-45676454 AGCATCTTAGGGAAGTGTTAGGG + Intronic
1126227716 15:46290248-46290270 AGCTGCTGAGAGAGGTGGTAGGG - Intergenic
1126506267 15:49407192-49407214 AGCTGCTTAGAAAAGTGGTAGGG - Intronic
1127098210 15:55535018-55535040 AGCTGCTCAGAGAACTGGTAGGG + Intergenic
1127121277 15:55774349-55774371 AGAGGCATAGAGAAGTCTCAAGG - Intergenic
1127856393 15:62957201-62957223 AGCTGCTTAGAAAACCCTCACGG - Intergenic
1129931070 15:79411744-79411766 AGTTGCTTGGAGAAGTGGTAGGG + Intronic
1130665450 15:85865467-85865489 AACTGCTTATAAAGGTCTTAGGG + Intergenic
1131377871 15:91940358-91940380 AGCTGCTTGGGGGAGTCTCACGG - Intronic
1135800480 16:25489416-25489438 AGCTGCTTAAAGAGGTGGTAGGG - Intergenic
1136077507 16:27827117-27827139 AACTGCATAGTGAAGTCTTAAGG + Intronic
1138960882 16:62027826-62027848 ATCTGGTTAGAGAATTCTGAAGG - Intronic
1138976553 16:62214626-62214648 GGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1139099055 16:63743833-63743855 AGCTGCTTAGAGAGGTGGCAAGG + Intergenic
1140438786 16:74970536-74970558 ACCTGCTTAGAGAGGTCCTTGGG - Intronic
1141070976 16:80954428-80954450 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1142336443 16:89492166-89492188 GGCTGCCTAGAGAAGGCTGAAGG - Intronic
1142759316 17:2034143-2034165 GGCAGCTTGGAGAATTCTTAGGG - Intronic
1143876022 17:9991358-9991380 AGCTGCTTACAAAATTCTTAGGG + Intronic
1144057385 17:11555091-11555113 AGCAGCTTAGAGATGGCTAAGGG + Intronic
1144521833 17:15957846-15957868 AGCTGCTTTGGGAAGTCTGCAGG - Intronic
1146228388 17:31087714-31087736 AGCTGCTTGAAGAAGTATCAGGG + Intergenic
1146233135 17:31131235-31131257 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
1149014629 17:51893570-51893592 AGTTGGCTAGAGAAGTCTGAAGG - Intronic
1149335298 17:55629515-55629537 TGCTGCTTATAGAAGTTTTGGGG - Intergenic
1152056745 17:78034507-78034529 AGCTGCTTGGGGAAGCCTCACGG - Intronic
1153094222 18:1382854-1382876 AGCTGCTTAGAATAGTGGTAGGG + Intergenic
1153406179 18:4742398-4742420 AGCTTTTTGGAGAAGTCTTTAGG - Intergenic
1153410637 18:4789067-4789089 AGCTGCTAAGAGAAGTGGTAGGG + Intergenic
1154400754 18:14034608-14034630 ACCTGCTTAGAGAGGTGGTAGGG + Intergenic
1155501918 18:26494867-26494889 TGCTGCTATGAAAAGTCTTAAGG - Intronic
1156432499 18:37091506-37091528 AGCTGCCTATACTAGTCTTAAGG - Intronic
1156896971 18:42257016-42257038 AGCTATTTAGAGAAGTCATAGGG - Intergenic
1158116824 18:54005231-54005253 AGGTGCCTAGATAAGTCTTTTGG - Intergenic
1160074135 18:75655762-75655784 TCCTGATTAGAGAAGGCTTATGG - Intergenic
1162221330 19:9179262-9179284 ACCTGGTTATAGATGTCTTAAGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166109897 19:40615331-40615353 AGGTGCTTAGTGAATTCTTGTGG - Intronic
1168605834 19:57759328-57759350 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
925553858 2:5106784-5106806 TGCTGCTTAGTGAAGTGGTAGGG - Intergenic
927578231 2:24218449-24218471 ATCTGCTTAGAGTTATCTTAGGG - Intronic
928490418 2:31777852-31777874 AGCTGCCCAGAGAAGTGGTAGGG + Intergenic
928728739 2:34206432-34206454 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
928805128 2:35140911-35140933 AGCTGCTTAGATAAGAATTGCGG - Intergenic
929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG + Intergenic
929520919 2:42650119-42650141 ACCTGCTTAAACAATTCTTACGG - Intronic
930930296 2:56874547-56874569 AGCTACTTAGAGAGGTAATAGGG + Intergenic
931489275 2:62726208-62726230 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
931890142 2:66662260-66662282 AGCTGCTTACAGAAGTGGTAGGG - Intergenic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
932539608 2:72638702-72638724 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
932708459 2:74045561-74045583 TGCTGCTTAGAGAAGGATTCAGG - Intronic
933340657 2:81021839-81021861 AGCTTTTTGGAGGAGTCTTAAGG + Intergenic
934219152 2:90065437-90065459 AGCTACTTAGAGAAATGATAGGG - Intergenic
935091351 2:99898016-99898038 AGCTGGGTTGACAAGTCTTAAGG + Intronic
935670115 2:105548080-105548102 AGTTGCTTAGAAAAGGTTTAAGG + Intergenic
935847939 2:107187278-107187300 AGATGCTTAGAGAAGTGGCAAGG + Intergenic
936281094 2:111140430-111140452 AGCAGTTTATAGAAGACTTACGG + Intronic
936811946 2:116413257-116413279 AGCTGCTTAAAGAGGTTATAGGG + Intergenic
937195853 2:120155999-120156021 AGCTGCTTAGAGAAGTGGTGGGG + Intronic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
940172631 2:150845393-150845415 ACAGGCTTAGAGAAGTTTTATGG - Intergenic
940531836 2:154887204-154887226 AGCTGCTTAGAAAGGTAGTAGGG - Intergenic
942405166 2:175646418-175646440 AGCTGCTCAGAGAAGTGGTAGGG + Intergenic
943092442 2:183390600-183390622 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
943093866 2:183405205-183405227 AGCTGCTTAGAGATGTGGTAGGG - Intergenic
943153131 2:184138813-184138835 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
945761494 2:213920877-213920899 AGCTGCTTAGAGAATTGGTAGGG - Intronic
945892734 2:215447493-215447515 ACCTGCTAAGAGAACTGTTATGG + Intergenic
1170651182 20:18243499-18243521 AGCTTTTTGGAGAAGTCTTCAGG - Intergenic
1171053520 20:21883600-21883622 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1171890080 20:30703671-30703693 AGATGCTTAGATAATACTTAGGG - Intergenic
1174007716 20:47423815-47423837 AGTTGCTTAGAGCAGCCTTCGGG - Intergenic
1176345903 21:5746396-5746418 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176352717 21:5866980-5867002 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176498924 21:7578059-7578081 AGCTGCTTAGAGAAGTGACAGGG + Intergenic
1176540224 21:8144466-8144488 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1176559175 21:8327511-8327533 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1177043956 21:16146424-16146446 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1177507882 21:22041094-22041116 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1180192553 21:46173015-46173037 AGCTGCTTAGAGAAGTGATGGGG + Intronic
1181328111 22:22066950-22066972 AGATGCGTAGAGAAGTCAGAAGG + Intergenic
1182313147 22:29423753-29423775 AGCAGCTTAGAGAAGTCATGGGG - Intergenic
1182419403 22:30241694-30241716 AGCTGCTCAGAGCAGTGTTCTGG - Exonic
1183334178 22:37237254-37237276 ACCCTCTTGGAGAAGTCTTAGGG + Intronic
1203245167 22_KI270733v1_random:60833-60855 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
949157302 3:844793-844815 TGCTGCCCAGAGAAGTCTTTAGG + Intergenic
949743682 3:7264368-7264390 AACTGCTTGGAGAAGTGGTAGGG - Intronic
951258747 3:20481977-20481999 AGCTGCTTAGAGAAGTGGTGGGG + Intergenic
952820001 3:37478149-37478171 AGCTTCTTAGGGGAGTCTCATGG + Intronic
953987255 3:47453921-47453943 TGATGTTTAGAGAAGGCTTATGG - Intronic
954509051 3:51105997-51106019 AGCTGCTTAGAGAAGTAGTAGGG + Intronic
954522713 3:51243264-51243286 AGCTGCTTAGAGAAGTGGTAGGG - Intronic
955937197 3:64113150-64113172 GGCTGCTTAGGGAAGTGTTGGGG + Intronic
957723192 3:84031401-84031423 AGCTGCATAGAGAAGTTCTGGGG + Intergenic
957878765 3:86183486-86183508 AGCTGTTTAGAGAAGTAGCAGGG + Intergenic
958464586 3:94442490-94442512 AGCTGCTTAGAGAAGTGGTGGGG + Intergenic
959041058 3:101423905-101423927 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG + Intergenic
959295585 3:104530820-104530842 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
959433547 3:106284784-106284806 ATCTGCTTAGAGAAGTGGTAGGG + Intergenic
959440047 3:106362909-106362931 AGCTACTTAGAGAGGTGGTAGGG - Intergenic
960258235 3:115533729-115533751 AACTGCTTAGAGAAGTAGCAGGG - Intergenic
960917721 3:122713989-122714011 AGAGGCTGAGAAAAGTCTTAGGG + Intronic
961933200 3:130555168-130555190 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
961987968 3:131157890-131157912 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
962195164 3:133355783-133355805 AACTGGTTAGATAAGTCTAAAGG + Intronic
962335699 3:134528012-134528034 AGCCACTTAGAGAAGTGATAGGG - Intronic
962401504 3:135063580-135063602 AGCTTTCTAGAGAAGTCTTCAGG + Intronic
962464981 3:135649541-135649563 AGCTGGTTAGAGAAGTGGTAGGG - Intergenic
962655818 3:137542943-137542965 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
963914188 3:150842437-150842459 AGCTGCTTAGAGAAATGATAGGG - Intergenic
964674184 3:159259032-159259054 GGGTGCTTAGAGAAGGCTTGAGG - Intronic
965378363 3:167955737-167955759 AGCTTTTTGGAGAAGTCTTTAGG + Intergenic
965805126 3:172534071-172534093 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
965851180 3:173027484-173027506 AGAAGCTTAGAGAATTCTGAGGG - Intronic
966289226 3:178335064-178335086 AGCTGCTCAGAGAGGTCATATGG - Intergenic
966714362 3:183000729-183000751 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
966925937 3:184644583-184644605 AGCTGCTTAGGGAAGTTCTGAGG - Intronic
967523641 3:190466490-190466512 AGCTACTTAGAGAAGTGGTAAGG + Intergenic
968610703 4:1555689-1555711 CGCTGCTTAGAGAAGTGGGAAGG - Intergenic
970101125 4:12524083-12524105 AGCTCCTTAGAGAAGTGGTAGGG + Intergenic
972123895 4:35740117-35740139 AGCTGCTTAGAGAAGTAGCAGGG + Intergenic
972270189 4:37503100-37503122 AGCTGCTAAGAGAAGTGGTAGGG - Intronic
972836526 4:42877281-42877303 AGCTGCCTAGAGATGACTTATGG + Intergenic
974240413 4:59238623-59238645 AGTTGCTTAGAGAAGTGGTAGGG - Intergenic
974581998 4:63815024-63815046 AGCTGCTCAGAGAAGTGGTGGGG - Intergenic
974603846 4:64123081-64123103 ATCTGCTTAGAGAAGTGGTAGGG - Intergenic
974650574 4:64748864-64748886 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
974723817 4:65774061-65774083 AGCGGATTAGAGAAGTACTAGGG - Intergenic
975119528 4:70713433-70713455 AGCAGCCTTGAGAAGTTTTAGGG - Intronic
975361677 4:73477638-73477660 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
975403674 4:73965577-73965599 AGCTGCTTAGGGAAGTGGTAGGG - Intergenic
975909154 4:79247877-79247899 AGCAGCTTAGAGAGGTGGTAGGG + Intronic
976948558 4:90799805-90799827 AGATGCTTAAAGAAGTGTTAAGG - Intronic
977482158 4:97592862-97592884 AGCTGCTTAGAGAGGTGGTAGGG + Intronic
977518778 4:98055600-98055622 AGCTGCTTAGAGAAGTGGTGGGG + Intronic
977696400 4:99971302-99971324 AGCTGCTTAGATAAGTGGTTGGG + Intergenic
978348217 4:107794062-107794084 AGCTGCATAAGGAAGTCTTGAGG - Intergenic
978596107 4:110379210-110379232 AGCTGCTTAGAGAAATGGTAGGG + Intronic
978868614 4:113546926-113546948 AGAAGCTGAGTGAAGTCTTAAGG + Intronic
978923606 4:114216828-114216850 TGCTGCTTAGATAAGTGGTATGG + Intergenic
979010084 4:115355809-115355831 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
979158656 4:117430002-117430024 AGCTGTTTAGAGAAGTGGTAGGG - Intergenic
979631895 4:122912092-122912114 ACCTCCTTTGAGAAGTCTTTGGG + Intronic
980549438 4:134314997-134315019 AGCTGCTTAAAGAGGCTTTAAGG + Intergenic
981276287 4:142901282-142901304 AGCTGCTTAGAAAAATAGTAGGG - Intergenic
981511795 4:145566059-145566081 AGCTGCTCAGAGAAGTGGTGGGG + Intergenic
981622192 4:146714412-146714434 GGCTGCTTAAAGCTGTCTTATGG - Intronic
981645309 4:146991829-146991851 AGCTGCTTACAGAGGTGGTAGGG - Intergenic
981849973 4:149218648-149218670 AGCTGCTTAGAGAAGTGTTAGGG + Intergenic
983420264 4:167507422-167507444 AACTGCTTAGAGAAGTGGTGAGG - Intergenic
983763723 4:171449496-171449518 AGCTGCATAGTGAGTTCTTACGG + Intergenic
984144542 4:176044724-176044746 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
984589217 4:181598260-181598282 AGCTGCTTAGAGAAATACTATGG - Intergenic
986142847 5:5048155-5048177 AGCAGCTTAGGGAAGTTGTAGGG + Intergenic
987914926 5:24200438-24200460 AGCTGCTTAAAGAAGTGTCAGGG + Intergenic
988053050 5:26055141-26055163 GGCTGCTTAGAAATGTCTTCTGG + Intergenic
988200787 5:28066298-28066320 AGCTGCTTAGAGAAGTGCTAGGG + Intergenic
988336334 5:29913568-29913590 AGGTGCTTAGAGAAGTGGTGGGG + Intergenic
988348311 5:30069372-30069394 AACTGCTTAGAGAAGTGGTAGGG + Intergenic
988864873 5:35324102-35324124 AGCTGCTTAGAAAAGTGGTAGGG + Intergenic
988870493 5:35384592-35384614 AGATGCTTAGAGAAGTGGTGAGG + Intergenic
988943522 5:36170413-36170435 AGCTGCTTAGCAAAGTCTGCAGG - Exonic
989067863 5:37481836-37481858 TGCTGCTTAGAAATGTCTTCTGG + Intronic
989086912 5:37685708-37685730 AGCTGCTCAGAAAAGTAGTAGGG - Intronic
989733830 5:44679203-44679225 AGCTGCTTAGAGAGGTGGCAGGG + Intergenic
989856649 5:46303603-46303625 ATCTGCTTAGTGATGTATTAGGG - Intergenic
990840869 5:60077753-60077775 AGCTGCTTAGAGAAGTGGAAGGG - Intronic
991028144 5:62052626-62052648 AGCTGCTTAGAGAGGTAGTAGGG - Intergenic
991577649 5:68121985-68122007 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
992253348 5:74897408-74897430 AGTTGTGTTGAGAAGTCTTATGG + Intergenic
992631806 5:78688929-78688951 CTCTGCTTAGAGAAGTCGTAAGG - Intronic
993228840 5:85204990-85205012 AGCTGCTTGGAGAGGTGGTAGGG - Intergenic
993429417 5:87813775-87813797 AGCTGCTCAGAGAGTTGTTAGGG + Intergenic
993795890 5:92267723-92267745 AGCTGCTTAGAGAAGTTGTAGGG + Intergenic
993811898 5:92490157-92490179 AGCTGCTTTTAGAAGTATTTGGG + Intergenic
993846208 5:92946917-92946939 AGATGATCAGAGAAGGCTTAAGG + Intergenic
993944032 5:94097006-94097028 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
994597611 5:101859950-101859972 AGCTGTTTACAGAAGTGGTAGGG + Intergenic
994970404 5:106730350-106730372 AGCTGCTAAGAGAAGTGGTAGGG + Intergenic
995894622 5:116997967-116997989 AGCTGCTTCGAGAAGTGGTAGGG + Intergenic
996045866 5:118873153-118873175 AGCTGCTTAGAGAACCCAGAGGG + Intronic
996954332 5:129164706-129164728 AGCTGCTTAAAGAAGTGGTAGGG - Intergenic
997188931 5:131912003-131912025 AGTTGCTTAGAAAAATGTTATGG + Intronic
997386722 5:133479378-133479400 TGCATCCTAGAGAAGTCTTACGG - Intronic
997887865 5:137647688-137647710 ACCTGCTTGGACAAGTCTTCTGG - Intronic
998276034 5:140754018-140754040 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
998756030 5:145380104-145380126 AGCAGCCTAGAGAAGTGGTAGGG - Intergenic
999202390 5:149825523-149825545 AGCTGCTCAGAGAAGGCATCTGG + Intronic
999260930 5:150238650-150238672 AGCTGGTTCCAGAAGTCTAAGGG + Intronic
999834261 5:155352415-155352437 AGCTGCTTAGAGAAGTGGCAGGG + Intergenic
1001553042 5:172618046-172618068 AGCTGCTCAGAGAAGGCTTCCGG - Intergenic
1002409539 5:179062648-179062670 TGGTGCTTAGAGAAGACTAAGGG + Intronic
1004090258 6:12493972-12493994 AGCTGCTTAGAGAAGTTGTAAGG + Intergenic
1004806188 6:19205877-19205899 AGCTGCTTAGAAAAGTGGTAGGG - Intergenic
1006199307 6:32272731-32272753 AGCTTCTTGGAGGAGTCTTCTGG - Intergenic
1006253236 6:32808046-32808068 AGCTGCTTAGAGAAGCCGTAGGG - Intergenic
1006939149 6:37740155-37740177 AGTTGCTCAGATAAGTCTTGGGG - Intergenic
1007353640 6:41294216-41294238 AGCTGCTTAGAGAGGTAGTAAGG + Intergenic
1008332466 6:50260714-50260736 AGCTGCTTAGTGAAGTGGTAGGG - Intergenic
1008687957 6:53945526-53945548 GACTGCTTAGAGAAGTGGTAGGG + Intronic
1008999386 6:57696065-57696087 TGCTGCCAAGAAAAGTCTTAAGG - Intergenic
1009589409 6:65646769-65646791 AGCTTTTTAGATAAGTCTTTAGG - Intronic
1009598795 6:65771585-65771607 AGCTGCTTGGAGAGGTGTTGGGG + Intergenic
1011337416 6:86276399-86276421 AGCTGCTTAGAGAAGTGATAGGG - Intergenic
1011877270 6:91976614-91976636 AGTTTCCTAGAGAAGCCTTAAGG + Intergenic
1011928046 6:92672753-92672775 AGCTGCTTACAGAAGTGGTAGGG + Intergenic
1012022588 6:93943810-93943832 AGATGCAGAGAGAAGGCTTATGG + Intergenic
1012490822 6:99780664-99780686 AACTGCTCAGAGAAGTGGTAGGG - Intergenic
1013106721 6:107032096-107032118 AACTGTTTTGAGAAGTTTTATGG + Intronic
1013393858 6:109714096-109714118 AGCTGCTCAGAGAAGTGGTAGGG - Intronic
1013410913 6:109882274-109882296 AGTTGCTTACAGAAGGTTTAAGG + Intergenic
1013737819 6:113248421-113248443 AACTGCTTAGAGAAGTGGTAGGG + Intergenic
1014514363 6:122362718-122362740 AGCTGCCTAGACATGTCTGAAGG + Intergenic
1014568172 6:122977024-122977046 AGCATCTTAGAGAAATTTTAGGG - Intergenic
1014841485 6:126225223-126225245 AGCTGCTTGGAGAATTGTTAAGG - Intergenic
1015678753 6:135780995-135781017 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1016237487 6:141886465-141886487 GGCTGCTTAGATAAGTGGTAGGG + Intergenic
1016453735 6:144210087-144210109 AGCTGCTTAGAGAACTGGTAGGG - Intergenic
1021425536 7:20495683-20495705 AGCTGCTTAGAGCAGTGGTAGGG + Intergenic
1021967287 7:25932975-25932997 AGCTTCTTAGAGAAGTGGTAGGG + Intergenic
1022313405 7:29219231-29219253 AGCTGCTTAGAAACGTTTTTAGG + Intronic
1022877695 7:34552294-34552316 AGCTGCTTAGGGAAGCAGTAGGG + Intergenic
1024385715 7:48748987-48749009 AGCTGATTAGAGAAGTGGTAGGG - Intergenic
1025272438 7:57537232-57537254 ACCTTCATAGAGAAGTCTAAAGG - Intergenic
1027158889 7:75788031-75788053 GGCTGCTTCGAGAAGGATTAGGG - Intronic
1027505779 7:79016115-79016137 AGCTGCTTAGAGAAGTAGTATGG + Intronic
1027554679 7:79648462-79648484 AGCTGCTTGGAGAAGTGGCAGGG - Intergenic
1027733766 7:81907086-81907108 AGCTGCTTAGAGAGGTGTTAGGG + Intergenic
1028008816 7:85614557-85614579 AGCTGCTTACAGAAGTGGTGTGG + Intergenic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1028639672 7:93028812-93028834 AGCTGCTTTGAAAAGTGGTAGGG + Intergenic
1029311859 7:99674713-99674735 AGCTATTCAGAGATGTCTTAAGG + Intronic
1030376122 7:108755399-108755421 GGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1030421259 7:109309598-109309620 AGCTGCTTGGAGAGGTGATAGGG + Intergenic
1030454950 7:109761098-109761120 AGCTGCTTAGAGAGTTGGTAGGG - Intergenic
1030748055 7:113192647-113192669 AGCTGTTTGGTGGAGTCTTAAGG - Intergenic
1030750819 7:113229704-113229726 AGCTTCTTAGAGAAAACATATGG - Intergenic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1031294259 7:119982807-119982829 AGCTGCTTAGAGAGGGAGTAGGG + Intergenic
1031656820 7:124366017-124366039 AGTTTCTTAGGGAATTCTTAGGG + Intergenic
1032484686 7:132276525-132276547 AGCTGCTTAGGGACGACTCAGGG - Intronic
1032999897 7:137492608-137492630 AGTTGCTTAGAGAGGTGGTAAGG + Intronic
1033133161 7:138762618-138762640 AGTTGGTTTGAGAAGTTTTAGGG - Intronic
1033494209 7:141877316-141877338 TGCTACTTAGAGAAGTGGTAGGG - Intergenic
1035151610 7:156878303-156878325 AGCTACTTGGAGGAGTCTTTAGG - Intronic
1037248227 8:16861893-16861915 ACCTGCTTAGAGAAATGTTATGG + Intergenic
1037431752 8:18820516-18820538 AGTAGCTTAGAGATGACTTAAGG - Intronic
1038170620 8:25128458-25128480 TGCTGCTTAGAGAAGTGGTAAGG + Intergenic
1039068352 8:33628735-33628757 AGCTGCTTAAAGTAGTTTGATGG + Intergenic
1039672036 8:39612484-39612506 AGCTGCTTGGAGAAGTGGCAGGG + Intronic
1040978002 8:53215264-53215286 AGCTGCTTAGAGAAATGGTAGGG - Intergenic
1041404538 8:57483520-57483542 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1041577925 8:59421212-59421234 ATCTGCCTAGAGAAGTGGTAGGG - Intergenic
1041651279 8:60305912-60305934 AGCTGCTTTGAGCAGGATTAGGG + Intergenic
1042325150 8:67520570-67520592 AGGTGCCTATAGAAGACTTACGG + Intronic
1042976826 8:74478749-74478771 AACTGCTTAGACAAGTGGTAGGG - Intronic
1043131961 8:76473087-76473109 AGCTGCTTAGAGAGGTGGTAGGG - Intergenic
1043656478 8:82674172-82674194 AGCTGCTTAGAGAACTCGTAGGG + Intergenic
1043698475 8:83251850-83251872 AGCTACTTAGAGAAGTGGTAGGG - Intergenic
1043738239 8:83774740-83774762 AGCTGCTTAGAGAGGGGTTAGGG + Intergenic
1044068520 8:87726326-87726348 AACTGGGTAGAGAAGTCTCAGGG + Intergenic
1044313694 8:90726143-90726165 AGCTGCTTAGAGAAGTGATAGGG + Intronic
1045225790 8:100244455-100244477 AGCTGATTGGAGCAGTCCTATGG - Intronic
1046846822 8:118926175-118926197 GGCTGCTTACAGAAGCGTTAAGG + Intronic
1046895019 8:119463217-119463239 AGCTGCTTGGAGAAATGGTAGGG + Intergenic
1047032714 8:120900188-120900210 AGCTTTCTAGAGAAGTCTTTAGG - Intergenic
1048119569 8:131564075-131564097 AGCTGCTTAGAGAAGGGCTAGGG - Intergenic
1048681316 8:136844276-136844298 AGCTTTTTGGAGGAGTCTTAAGG - Intergenic
1048727210 8:137400342-137400364 AGCTGCTTAGAGAGGTGCTAGGG + Intergenic
1049128022 8:140810195-140810217 AGCTGCTTAGAGAAGTGCTAGGG + Intronic
1050424756 9:5501775-5501797 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1050475265 9:6034422-6034444 AGCTGCTTAAGGAAGTGGTAGGG + Intergenic
1050676054 9:8053955-8053977 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1052142564 9:25004641-25004663 AGCTGATTAGAGAAGTGGTAGGG - Intergenic
1052534113 9:29726320-29726342 AGCTGCTTAGAACAGTGGTAAGG + Intergenic
1053896772 9:42749551-42749573 AGCTTTTTAGTGAAGTCTTTAGG - Intergenic
1057105713 9:92413314-92413336 AGCTGCTTAGAAAAGCAGTATGG - Intronic
1057250491 9:93497304-93497326 AACGGCTTAGGAAAGTCTTAGGG + Intronic
1058071969 9:100610402-100610424 AGCTGACTAGAGAAGCCTTTGGG + Intergenic
1059792471 9:117654898-117654920 AGCTTATTAGAGAGGTCCTATGG + Intergenic
1061394535 9:130336874-130336896 AGCCCCTTATAGAATTCTTAGGG - Intronic
1203461502 Un_GL000220v1:43902-43924 AGCTGCTTAGAGAAGTGACAGGG - Intergenic
1187223797 X:17356202-17356224 AGCTGTTTAGAGAAGGCTTCAGG + Intergenic
1187644097 X:21328164-21328186 AGCTGGCTAGAGAAGTGATAAGG + Intergenic
1188492992 X:30755789-30755811 ATCTGCTTAGAGAAGTAGTAGGG + Intergenic
1188725645 X:33578602-33578624 AGCTCCTTAGAGATGTCGTAGGG - Intergenic
1188768615 X:34126469-34126491 AGCTACTTAGAGAAGTGGTGGGG - Intergenic
1188806869 X:34601666-34601688 AGCTGCTTAGAGTAGTGGTAGGG - Intergenic
1188833691 X:34931671-34931693 AGCTGCTTAGAAAAGTGGTAGGG + Intergenic
1188835293 X:34947823-34947845 AGCCACTTAGAGAAGTGGTAGGG + Intergenic
1189040533 X:37537940-37537962 AGTTACTTAGAGAAGTAGTAGGG - Intronic
1189678237 X:43486510-43486532 AGCTGCTTAGAGAGGTGATAAGG + Intergenic
1189850698 X:45173681-45173703 AGCTACTTAGAGAAGGCTGAGGG - Intronic
1191038921 X:56057864-56057886 ACCTGCTTAAAGAAGTGGTAAGG - Intergenic
1191161195 X:57331183-57331205 AGGTGCTCAGAGAAGTGGTAGGG - Intronic
1191597251 X:62959406-62959428 AGCTGATTAGAGAACTGGTAGGG + Intergenic
1191609941 X:63101740-63101762 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1191729179 X:64315142-64315164 AGAAGTTTAGAGAAGTGTTAGGG - Intronic
1192249485 X:69399503-69399525 TGCTGCTTAGAGATTTCTTCTGG + Intergenic
1192419429 X:71015808-71015830 AGCAGCTTACAGAAGTTTAAGGG - Intergenic
1192659848 X:73030608-73030630 AGCTGCTTAGAGAAGTGGTTGGG + Intergenic
1192693516 X:73390729-73390751 AGCTGCTTAGAGAGGTGGCAGGG + Intergenic
1192872282 X:75195535-75195557 AACTGCTTAGAGAAGTGGCAGGG - Intergenic
1192935197 X:75851317-75851339 AGCTGCTTAGAGAAGGGTTAGGG - Intergenic
1193056666 X:77159717-77159739 AGCTGTTTAGAGAAGTGGTAGGG + Intergenic
1193351398 X:80468997-80469019 AGCAGTTTAGAGATTTCTTAAGG - Intergenic
1193483678 X:82059726-82059748 AGGTGCTTAGAGAAATAATAGGG + Intergenic
1193492365 X:82165538-82165560 ACCTGCTTAGAGAAGTGACAGGG + Intergenic
1193580707 X:83259708-83259730 AGCTGTTTAGAGAAGTGGTAGGG + Intergenic
1193593451 X:83418865-83418887 AGGTGCTTAGAGAAGTGGTAGGG + Intergenic
1193611040 X:83631640-83631662 TGCTGCTTAGAGAAATGGTAGGG - Intergenic
1193703330 X:84790726-84790748 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1193749761 X:85327105-85327127 AGATGCTTAGAGAAGTGGTAGGG - Intronic
1193790325 X:85808732-85808754 AGGTGCTTAGAGAAGTGGTAGGG - Intergenic
1193823439 X:86194681-86194703 AGCTGCTTAGAGAAGTGGTAGGG + Intronic
1193883891 X:86960926-86960948 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1193891394 X:87050266-87050288 AGCTGCTTAGAGAGGTGGCAGGG - Intergenic
1193923248 X:87455163-87455185 AGCTGCTTAGAGAATTGGTAAGG + Intergenic
1193960024 X:87914228-87914250 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1194028109 X:88779290-88779312 AGCTTCTTGGAGGAGTCTTTAGG + Intergenic
1194323625 X:92481784-92481806 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1194344965 X:92751599-92751621 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1194346585 X:92773200-92773222 AGCTGCTTAGAGAAATGGTAGGG + Intergenic
1194465866 X:94234882-94234904 AGCTGCTTAGAGAAGTTACAGGG + Intergenic
1194512660 X:94814681-94814703 AGTTGCTTAGAGAGGTGTTAGGG - Intergenic
1194526058 X:94978468-94978490 AGCTGCTTAGAGAAGGGGTATGG - Intergenic
1194549094 X:95274020-95274042 AGCTACTTAGAGAAGTTGTAGGG + Intergenic
1194663795 X:96655604-96655626 TGCTGCTTAGAGAAGTGGTGGGG + Intergenic
1194774300 X:97944068-97944090 AGTTGCTTAGAGAGGTAGTAGGG + Intergenic
1194848318 X:98839257-98839279 AGCTGCTTGGAGAAGTGACAGGG - Intergenic
1194925552 X:99819638-99819660 AGCTGCTTAGAGAAGTGGTAAGG + Intergenic
1195270064 X:103220480-103220502 AGCTGCTCAGAGAAGTGGTAGGG + Intergenic
1195533403 X:105982840-105982862 AGCTGCTTAGAAAAGTAGTAGGG - Intergenic
1195548303 X:106138360-106138382 AGCTGCTTAAAGAAATGTTAGGG + Intergenic
1195567950 X:106363862-106363884 AGCTGCTTAGAGAAGTAGTAGGG - Intergenic
1196468090 X:115993323-115993345 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1196554359 X:117069923-117069945 AGCTGCTCAGAGAGGTCATATGG + Intergenic
1196584002 X:117408840-117408862 AGCTACTAAGAGAAGGCGTAGGG + Intergenic
1197141382 X:123121491-123121513 AGCTGCTCAGAGAAGTTGTAGGG + Intergenic
1197370700 X:125622151-125622173 AGCTTCTTAGAGAAGTGGTAGGG - Intergenic
1197378793 X:125713514-125713536 ATCTGCTTAGAGAAGTAGTGGGG + Intergenic
1197404331 X:126030427-126030449 AGCTACTTAGAGAACTGATAGGG - Intergenic
1197570616 X:128146732-128146754 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1198779676 X:140221443-140221465 AGCTGCTTACAGAAGTGGTCAGG + Intergenic
1198885129 X:141327209-141327231 TGCTGCTCAGAGAAGTGGTAGGG + Intergenic
1198975185 X:142327983-142328005 AGCTGTTTAGAGAAGCGGTAGGG - Intergenic
1199136960 X:144265468-144265490 AGCTGCTTAGAGAAGTGGTAGGG + Intergenic
1199270172 X:145873410-145873432 AGCTGCTTAGAGAAGAGGTAGGG - Intergenic
1199400088 X:147389241-147389263 AGCTGCTTAGAGAGGTGGTAGGG + Intergenic
1199560915 X:149161597-149161619 AGCTGCTTAGAGAAGTGTTAGGG + Intergenic
1199640675 X:149858242-149858264 AGCTACTTAGAGAGGTGGTAGGG + Intergenic
1199786727 X:151112650-151112672 AACTGCTTGGAGAAGTGGTAGGG - Intergenic
1200631727 Y:5594946-5594968 AGCTGCTTAGAGAAGTAGTAAGG - Intronic
1200653305 Y:5868241-5868263 AGCTGCTTAGAGAAGTGGTAGGG - Intergenic
1200654922 Y:5889844-5889866 AGCTGCTTAGAGAAATGGTAGGG + Intergenic
1201581767 Y:15517540-15517562 GGCTGCTTAGAGCAGTATTAGGG - Intergenic
1202052444 Y:20795258-20795280 AGCAGATCAGAGAATTCTTAGGG - Intergenic