ID: 1030810335

View in Genome Browser
Species Human (GRCh38)
Location 7:113964096-113964118
Sequence CCTTATAGGGAGTCCATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030810335 Original CRISPR CCTTATAGGGAGTCCATGCA TGG (reversed) Intronic
901066852 1:6498336-6498358 CCATGTAAGGAGTCCATGCAGGG - Intronic
904243288 1:29165832-29165854 TCTTATAGAGAGACCATCCAAGG - Intronic
919563095 1:199147895-199147917 AGTTATAGGAAGTGCATGCATGG + Intergenic
919921421 1:202168639-202168661 CCTGGAAGGGAGTCCAGGCAGGG + Intergenic
920739442 1:208566529-208566551 TCTTACAGGGAGTCCATTCTAGG - Intergenic
920826765 1:209430127-209430149 CCCTGTAGCGAGCCCATGCATGG + Intergenic
921544437 1:216457543-216457565 CCTTACAGTGAGTCCATGCAAGG + Intergenic
922795846 1:228339079-228339101 CCCTACAGTGTGTCCATGCATGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
1063429384 10:5976432-5976454 TCCTATAGAGAGTCCATGGATGG + Intronic
1068708910 10:60110196-60110218 CCAGCTAGGAAGTCCATGCAAGG - Intronic
1072468903 10:95693702-95693724 CACTGTAGGGAGTCCAGGCACGG + Exonic
1072657068 10:97337222-97337244 CCTCAGAGGGAGGCCAGGCAGGG - Intergenic
1083166300 11:60890225-60890247 CCTTATAGGGAATTCCTGTAGGG - Intergenic
1089964832 11:122647343-122647365 CCTTAAAGGCAGTCCCTGAAGGG - Intergenic
1091367641 11:135035829-135035851 CCTTTTAGGGTGTGCATACACGG - Intergenic
1102729354 12:115094391-115094413 CCTTCAAGGGAGGCCATGGAAGG + Intergenic
1117015389 14:51512550-51512572 CCTTAAAGCTAGCCCATGCAAGG + Intronic
1120628506 14:86859265-86859287 ATTTCTAAGGAGTCCATGCATGG - Intergenic
1129566197 15:76625668-76625690 CCAGAGAGGGAGTCCATGCTTGG - Intronic
1133337628 16:5016279-5016301 CCTTTTGGGGAGTCCAGGAAAGG - Exonic
1136494015 16:30630487-30630509 CCTTGGAGGGATTCCAGGCATGG + Intergenic
1148056843 17:44803741-44803763 CCTATTAGGGATTCCAGGCATGG + Exonic
1155017678 18:21861623-21861645 TCTTATAGGGACTCCCTTCAAGG + Intronic
1156155430 18:34296176-34296198 TCTTATAGGGTGTCCTTACATGG - Intergenic
1159059188 18:63496923-63496945 TCTTAAAGGGAGCCCATGGAAGG - Intronic
1166096545 19:40542752-40542774 CCTTATTGGGACTCAAGGCAAGG + Intronic
1168239971 19:55083994-55084016 CCTCCTAGGGAGCCCAGGCATGG - Intronic
927731395 2:25475808-25475830 CCTTTTATGGAGTGCAGGCAAGG - Intronic
928884981 2:36138072-36138094 TCTCAGAGGGAGTTCATGCATGG - Intergenic
933188365 2:79304036-79304058 ACATATTGGCAGTCCATGCAGGG + Intronic
933448974 2:82421539-82421561 CCTGATAGGGAGTTGATGAAAGG - Intergenic
935088707 2:99873643-99873665 CCTTATAGCCAGTCCATAGATGG - Intronic
941468334 2:165856115-165856137 CCTTAAAGGGAGGCCATGGGAGG + Intergenic
948203589 2:236148164-236148186 TCTTTTAGGGAGTCCATGAGGGG - Intergenic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1172301070 20:33850815-33850837 CCTCACAGGGAGTCATTGCAGGG + Intronic
1178517704 21:33262965-33262987 CCTGACAGTCAGTCCATGCATGG - Exonic
1179608601 21:42534166-42534188 ACTCATAGGAAGTCCAAGCATGG - Intronic
950283753 3:11728716-11728738 CCTGACAGGGAGGCCAGGCACGG + Intergenic
953138621 3:40206114-40206136 GCTGATATGGAGTCCATGGATGG - Intronic
955197405 3:56817893-56817915 CTTTATAGGAAGGCCACGCATGG + Intronic
958662070 3:97082551-97082573 CTTTAAAGGGAGTGTATGCAAGG - Intronic
969651371 4:8470084-8470106 CCTGTTATGGAGTCCATGCTGGG + Intronic
970451994 4:16178118-16178140 CCTAACAGGGTGTCCATGAAGGG - Intronic
975104921 4:70556767-70556789 CCTCATAGGCACTCCATCCATGG + Intergenic
984768886 4:183420666-183420688 CCTCATAGAGAGTCCTTGCTGGG + Intergenic
985751603 5:1681837-1681859 CCTGAGAGGAAGTTCATGCAGGG - Intergenic
1001537053 5:172505459-172505481 CCATCTAGGGAGTCGATGCAGGG - Intergenic
1003760872 6:9177394-9177416 CTTTATAGGGATTCCAGGCATGG + Intergenic
1005170012 6:22972909-22972931 CCTTCATGGGAGTCCTTGCATGG - Intergenic
1013767051 6:113587173-113587195 CCTGGAAGGGAGTCCATCCAGGG - Intergenic
1020383519 7:7571037-7571059 CCTTATTAGGAGTCTATGCCAGG + Intronic
1023818595 7:43968231-43968253 CCTTCTAGTGAGTCCTAGCAGGG - Intergenic
1029743644 7:102505196-102505218 CCTTCTAGTGAGTCCTAGCAGGG - Intronic
1029761630 7:102604359-102604381 CCTTCTAGTGAGTCCTAGCAGGG - Intronic
1030810335 7:113964096-113964118 CCTTATAGGGAGTCCATGCATGG - Intronic
1031980714 7:128122527-128122549 CCTTCTAGGGAGTCCAGCCTGGG - Intergenic
1034218156 7:149423214-149423236 CCTGATAAGGAGTCCAGGGACGG - Intergenic
1039567532 8:38562006-38562028 TCTTATCTGAAGTCCATGCATGG + Intergenic
1047608615 8:126498779-126498801 CCTTATAGGAAGTCCTTCAAGGG + Intergenic
1048385531 8:133909209-133909231 ATTTTTAGGGAGACCATGCAGGG + Intergenic
1060775794 9:126373291-126373313 CCTGTTAGGGAGTCCACGGATGG + Intronic
1189120971 X:38394639-38394661 CATTAAAGGGAGGCCATGGAGGG - Intronic