ID: 1030811321

View in Genome Browser
Species Human (GRCh38)
Location 7:113975630-113975652
Sequence GTCACTGAGGGCCCCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030811321 Original CRISPR GTCACTGAGGGCCCCCACAA TGG (reversed) Intronic
901457203 1:9369898-9369920 GACTCTGAGGACGCCCACAATGG - Intergenic
901878454 1:12180433-12180455 GGCATTGAGGGCCCCCACCTCGG + Intronic
902573572 1:17362519-17362541 GGCACTGAGGACCCCCAAAATGG + Intronic
906199249 1:43948524-43948546 GTCCCTGAGGGGCCAAACAAGGG + Intronic
907870398 1:58437804-58437826 GACACTGAGGGCCCTCTCAGTGG + Intronic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
920823102 1:209399773-209399795 GTCACTGAGCTCCCTCACAGGGG - Intergenic
922786288 1:228283883-228283905 GTCACTGAGGCTCCCCAGCATGG + Intronic
924537282 1:244946402-244946424 ATCACTGAGGGCCACCCCAGAGG + Intergenic
1067799841 10:49351369-49351391 GTCATTGAGGGCTGCCACAGTGG + Intergenic
1068528150 10:58154655-58154677 GTCACTGATGACTCTCACAACGG + Intergenic
1072518535 10:96210224-96210246 CTCAGTGAGGACCCCCACAGAGG + Intronic
1074901534 10:117820210-117820232 GTCCCTGAGGGCCTCCACAGAGG + Intergenic
1075823111 10:125331042-125331064 TTCACTCAGGGCCACCCCAAGGG + Intergenic
1081375399 11:42352314-42352336 GTCCCTTAGAGCCCCCAGAAAGG + Intergenic
1084646756 11:70463513-70463535 GTCACTGGGGGCCCCCACTCTGG - Intergenic
1084954893 11:72685895-72685917 GCCTATGAGGGCCCCCACCAAGG + Intronic
1085807623 11:79650790-79650812 GTCACTGATGGCCAGCACACAGG - Intergenic
1091811257 12:3399688-3399710 GTCATTGAGGGCCCTCCCAAAGG - Intronic
1092510879 12:9154807-9154829 GTCTCTGAGGGCGCTCCCAATGG + Exonic
1094240734 12:28221035-28221057 GTAACTGGAGGCCCCCAAAAAGG - Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106550786 13:30769157-30769179 GTCACTCAGGCCCCAAACAAAGG + Intergenic
1115153947 14:30317035-30317057 GTCAATGAAGGCCCCCACCAAGG + Intergenic
1119067903 14:71549178-71549200 GTCACTGTGGGCCCCCTGGAAGG - Intronic
1121714087 14:96060300-96060322 GTCTCTGCTGGCCCCCACACTGG + Intronic
1121983287 14:98474013-98474035 GTCACTCAGGAGCCCCACAATGG + Intergenic
1122414700 14:101543293-101543315 GCCACTGAGGACCCTCACATGGG + Intergenic
1122628573 14:103097185-103097207 GTCACTGAGAGCTCCCACCCTGG - Intergenic
1122865838 14:104603627-104603649 CTCACAGAGGGCACCCACAGAGG + Intronic
1122971622 14:105154579-105154601 GTCAGCAAGGGCCTCCACAAGGG - Intronic
1125750048 15:42021732-42021754 CTCACTGAGGGGCCTGACAAGGG + Intronic
1130036425 15:80365558-80365580 GTCACTCCGGGTCACCACAAGGG - Intronic
1131699369 15:94917582-94917604 GTCACTGAGGCCTCCAACCATGG + Intergenic
1132584824 16:701558-701580 GTCCCTGGGGGCTCACACAAGGG + Intronic
1132760859 16:1508059-1508081 GTCACAGAGGGACCCCAACAGGG - Intronic
1134677418 16:16100280-16100302 GTCACTGAGCGCAGCCACCATGG - Intronic
1136061646 16:27730707-27730729 GTCACTGGAGACCCCCACAAGGG - Intronic
1138414677 16:56864910-56864932 GACCCTGAGGGGCCCCATAAGGG - Intergenic
1143513696 17:7408813-7408835 GTCCCTCACTGCCCCCACAAAGG - Intronic
1143671569 17:8399641-8399663 GTCCCAGAGGGCCGCCACAGTGG - Intergenic
1160734900 19:658017-658039 CGCACTGGGGGCCCCCACAGAGG + Intronic
1160837511 19:1131777-1131799 GTCACTGAGGGCCCCCGTCCGGG + Intronic
1161234277 19:3190204-3190226 GTCCCTGAGGGGCCTCCCAAGGG + Intronic
1161575586 19:5052673-5052695 GGCACTGTCGGGCCCCACAATGG + Intronic
1161773338 19:6243227-6243249 GTCAGTGGGGGCCCCCACCCCGG + Intronic
1164849310 19:31468370-31468392 GACACTGAGGACCCCAAAAAGGG + Intergenic
1168586754 19:57600113-57600135 GGCACTGAGGGCCCCGACCCAGG + Exonic
925902487 2:8518379-8518401 GTCACTGAGGTCCCTGGCAATGG + Intergenic
926238714 2:11069004-11069026 GTCACTGAGAGGCCTGACAAGGG + Intergenic
928605413 2:32941272-32941294 GGCACTGAGGGCCAGCACGAGGG + Intergenic
929714915 2:44300301-44300323 GTCACTGAAGGACTCCTCAAGGG - Intronic
934887334 2:98036550-98036572 GTCCCTCAGGGGCCCCACACAGG + Intergenic
936405053 2:112195502-112195524 GCCACTCAGGGCCCCAGCAAGGG - Intergenic
942643152 2:178082010-178082032 GTGCCTGAAGTCCCCCACAATGG - Intronic
1169392938 20:5204879-5204901 GTGACTGGGGACCCCCAAAAAGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172073576 20:32277274-32277296 GTCACTGGGGGCACCCTAAATGG + Intergenic
1172481317 20:35273569-35273591 GTCTCTGAGGCTCCCCAAAAAGG - Intronic
1172644857 20:36462706-36462728 GGCTCTGAGGCCTCCCACAAAGG + Intronic
1173776697 20:45714478-45714500 GTGACTGAGGGCTCCCAGCAGGG - Intergenic
1175503961 20:59469107-59469129 GTCACCCAGGGCCCCCTCCAGGG - Intergenic
1175711177 20:61222233-61222255 CTCACTTAGGGCCTCCAGAAAGG + Intergenic
1176044091 20:63083513-63083535 GTCACTGAGTGCCCGGACCAGGG + Intergenic
1176287180 21:5024299-5024321 GCCACTAAGGGCCCCCACGTGGG + Intronic
1178544587 21:33481973-33481995 GTTAGTGAGGGGCTCCACAATGG + Intergenic
1178616276 21:34135828-34135850 GTTAGTGAGGGACTCCACAATGG + Intronic
1179870001 21:44239176-44239198 GCCACTAAGGGCCCCCACGTGGG - Intronic
1180125714 21:45788650-45788672 CTCACTGTGGGCCGCCACGAGGG + Intronic
1180741380 22:18055423-18055445 GTCACTGCAGGCCACCAGAAAGG - Intergenic
1182114970 22:27751138-27751160 GTCTCTGAGGGACACCATAATGG + Intronic
1182305049 22:29362127-29362149 GTCACTGGGCGCTCCCACAGGGG + Intronic
1182312361 22:29418263-29418285 GTCACTGGGCGCTCCCACAGGGG + Intronic
949857756 3:8477611-8477633 GCCACAAAGGCCCCCCACAAAGG + Intergenic
950611957 3:14132627-14132649 ACCACTGTGGGCCCCCACCATGG - Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
953188849 3:40664641-40664663 CTCCATGAGGGCACCCACAATGG - Intergenic
953903083 3:46854202-46854224 GTGACTGAGGACCCACACAGAGG - Intergenic
954241665 3:49298658-49298680 GTCACAGGGGTGCCCCACAAAGG + Intronic
956086940 3:65621539-65621561 TTCACTGGGGGTCTCCACAAAGG + Intronic
956467374 3:69532825-69532847 GTCAGTGGGGGACCCAACAATGG - Intronic
962915203 3:139894959-139894981 TGCACTGTGGGCCCTCACAAGGG + Intergenic
963320816 3:143807402-143807424 GTCAGTGAGGCCCCACACTATGG - Intronic
965700009 3:171451047-171451069 GTCACTGAGGGCCCTCTTAGAGG - Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
983940502 4:173530697-173530719 GGCGGTGGGGGCCCCCACAAAGG + Intergenic
985266769 4:188158402-188158424 GTTACTGGGGGACCCCACAGAGG - Intergenic
985517192 5:353134-353156 GCCACTCTGGGGCCCCACAAAGG - Intronic
986279862 5:6314213-6314235 GCTACTGAGAGCACCCACAAAGG - Intergenic
987071045 5:14337461-14337483 GTCACTGAGGACCTTCACAGAGG + Intronic
988068183 5:26250543-26250565 GTCACAAAGGACCCCCACTAGGG - Intergenic
998139297 5:139690780-139690802 GTCCCTGAGGGCCAGCAAAATGG - Intergenic
998604607 5:143621069-143621091 GTCAGTGAGGGCCCTGTCAAGGG - Intergenic
999270550 5:150294259-150294281 GTCCCTGAGGTCTCCCACACAGG + Intergenic
999339949 5:150761832-150761854 GGCAGTAAGGGCCCCCACAGGGG - Intergenic
1004183021 6:13397133-13397155 ACCACTGTGGGCACCCACAATGG - Intronic
1005481548 6:26259747-26259769 GTTACTGAGGAACCCCACCAGGG - Intergenic
1005932457 6:30493770-30493792 GCCACAGAGGGCCCCCACCAGGG + Exonic
1013167163 6:107604690-107604712 GTCACTGGGGGCGCCCTCACAGG - Intronic
1013480088 6:110545488-110545510 GTAAGTGATGGCCCCCAAAAAGG - Intergenic
1015876060 6:137824063-137824085 GTCACTGCTTGCCACCACAAAGG - Intergenic
1018386696 6:163310840-163310862 GTCACCGAGGGCCACCGCAATGG - Intronic
1020051792 7:5086661-5086683 GTACCTGAAGCCCCCCACAAGGG + Intergenic
1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG + Intergenic
1026036286 7:66832688-66832710 GTAACTGAGGCCCCCCAGAGGGG + Intergenic
1026983204 7:74538450-74538472 GTGACTGAGGCCCCCCAGAGGGG - Intronic
1028827436 7:95289695-95289717 GTCACAGAGGGCTCCAAGAAGGG - Intronic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1036822848 8:11953949-11953971 GTCACTCAGAGCCTGCACAAAGG + Intergenic
1038712110 8:29957060-29957082 GTCACTGGGGGCCCCTGCCAAGG + Intergenic
1040285908 8:46100256-46100278 CTCGCAGAAGGCCCCCACAAAGG - Intergenic
1040286908 8:46105144-46105166 CTCGCGGAAGGCCCCCACAAGGG - Intergenic
1040287947 8:46109979-46110001 CTCGCGGAAGGCCCCCACAAAGG - Intergenic
1040313673 8:46249779-46249801 CTCACAGAAGGCCCCCACTAGGG + Intergenic
1040342375 8:46447455-46447477 CTCACAGAAGACCCCCACAAGGG - Intergenic
1041081458 8:54218716-54218738 GCCCCTGAGGGTCCTCACAAAGG + Intergenic
1046946893 8:119982649-119982671 GACACTGAGACTCCCCACAAAGG + Intronic
1047012280 8:120685219-120685241 ATCACAGAGAGCCCCCACTAAGG - Intronic
1048294329 8:133203213-133203235 GTCCCTGAGAATCCCCACAAGGG + Intronic
1048961822 8:139586045-139586067 GTGAATGAGGGCCCCTAGAAGGG - Intergenic
1049466358 8:142752787-142752809 GTCAAGGAGGGTCCCCACAAAGG - Intergenic
1057221190 9:93258887-93258909 GTCAGTGTGGGCCCCAACCAGGG - Intronic
1061911953 9:133729655-133729677 GGCAGTGAGGGGACCCACAAGGG + Intronic
1061945991 9:133908397-133908419 GTGACCGAGGGCCCCCACTGGGG - Intronic
1186993636 X:15096100-15096122 GTCATTGAATGGCCCCACAAAGG + Intergenic
1189079822 X:37959140-37959162 GTCACGGAGAGTCCCCACTAGGG - Intronic
1189955035 X:46269215-46269237 GTCCCTGAGAGCCCCCATCAAGG + Intergenic
1197089824 X:122523395-122523417 GTCACTGTTGGGGCCCACAAAGG - Intergenic
1200932886 Y:8712946-8712968 TACACTGCAGGCCCCCACAAAGG + Intergenic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic