ID: 1030811376

View in Genome Browser
Species Human (GRCh38)
Location 7:113976374-113976396
Sequence AAATAAGCACAGATGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 1, 2: 5, 3: 42, 4: 483}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030811376 Original CRISPR AAATAAGCACAGATGGAGAG TGG (reversed) Intronic
900464531 1:2818612-2818634 ACATATGCACACATGCAGAGAGG - Intergenic
901153861 1:7122591-7122613 AAATAAGCCCTGTTGCAGAGGGG - Intronic
901234638 1:7661366-7661388 GAACAAGGACAGAAGGAGAGTGG - Intronic
902373969 1:16021626-16021648 GAAAAAGCACAGAGGGAGAGGGG - Intronic
902378892 1:16043461-16043483 GGAAAAGCACAGAGGGAGAGGGG - Intergenic
903133401 1:21293594-21293616 AAATCAGCAGAGATGGAGCCTGG + Intronic
905660289 1:39717309-39717331 AAAAAAGCACAGATGGAATTGGG - Intronic
905751917 1:40472720-40472742 AAATACCCACAGGTGTAGAGGGG + Intergenic
906093034 1:43199010-43199032 AAATAAGCATCAATGGTGAGAGG + Intronic
906518460 1:46453325-46453347 ACAGAAGCAGAGAGGGAGAGAGG + Intergenic
906601859 1:47137415-47137437 ACTTAAGCACAGGTGGACAGGGG + Intronic
907443747 1:54494451-54494473 AAAGAAGCACAGTTGGTGAGTGG + Intergenic
907487382 1:54787216-54787238 AGAGAAGCAAAGGTGGAGAGAGG + Intronic
908457977 1:64322516-64322538 AAAAGACCAGAGATGGAGAGGGG + Intergenic
909050687 1:70764230-70764252 TGATAAGCAGAGAAGGAGAGGGG + Intergenic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
909857720 1:80560252-80560274 AAATAAACACGTATGAAGAGGGG - Intergenic
910472528 1:87570780-87570802 AAGTTAGCTCAGATGTAGAGTGG + Intergenic
910607719 1:89105329-89105351 AAATGAGCAGAGATAAAGAGAGG - Intergenic
910966218 1:92810655-92810677 AGATAAGCCAAAATGGAGAGTGG - Intergenic
911439158 1:97903927-97903949 AAATAGGAGAAGATGGAGAGGGG + Intronic
911590397 1:99741141-99741163 AAATAAGGAAAGAGGGACAGAGG - Intronic
911633211 1:100205873-100205895 AAATGAGAACACATGGACAGAGG + Intronic
912642578 1:111361431-111361453 AAATACCCACAGATGTGGAGGGG - Intergenic
912837617 1:113010122-113010144 AAATAAACAAATATGGAAAGGGG + Intergenic
913042042 1:115036515-115036537 AAATAAGAACTCAAGGAGAGAGG - Intergenic
913087618 1:115453444-115453466 AGATAAGCACAGCTTGGGAGTGG + Intergenic
913364179 1:118017287-118017309 TAACAAGAACAGAAGGAGAGGGG - Intronic
914432247 1:147629319-147629341 AAATAAGCCTAGAGAGAGAGTGG + Intergenic
915439777 1:155938472-155938494 AAAAAAGAAAAGATGGAGGGTGG + Intergenic
915714142 1:157928766-157928788 AAAAAAGCAAAGTTGGTGAGAGG + Intergenic
916039072 1:160946917-160946939 AAATACCCACAGATGTGGAGGGG - Intronic
917160112 1:172047799-172047821 AAATAAGAATAGGTGGGGAGGGG + Intronic
917636201 1:176939319-176939341 AAACAAGCACAGATGTTGGGTGG + Intronic
917869786 1:179230646-179230668 AAGTAAACACAGTGGGAGAGGGG - Intergenic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
918133422 1:181648127-181648149 AAATCTCCACAGATTGAGAGGGG + Intronic
918465795 1:184820353-184820375 AAGTAGGCACAGAGGGAGAGTGG - Intronic
919304339 1:195810845-195810867 AGAAAAGCACAGATGGAAATAGG + Intergenic
921636853 1:217505772-217505794 AAATAACCATAGATGGCTAGTGG - Intronic
921967628 1:221107384-221107406 AAATAAGGAAAGAAAGAGAGTGG - Intergenic
922076260 1:222247912-222247934 GGATAAACAGAGATGGAGAGGGG - Intergenic
923222072 1:231904388-231904410 AAGTAAGCACTGCTGGAGAGGGG + Intronic
923636864 1:235706923-235706945 AAATAAGCTCAGATATGGAGTGG + Intronic
924082786 1:240416605-240416627 ACATAAGTACAGATGGAATGAGG - Intronic
924829963 1:247582963-247582985 AAATACCCACAGATGTGGAGGGG + Intergenic
924850328 1:247822608-247822630 ACATAATCACAGAGGCAGAGAGG - Intergenic
1062895286 10:1098309-1098331 AAAAACGGACAGATGGGGAGGGG - Intronic
1063107093 10:3001919-3001941 AAAGAAACAGAGAAGGAGAGTGG + Intergenic
1063994327 10:11603870-11603892 AAATACACACAGGTGAAGAGAGG + Intronic
1065748232 10:28861257-28861279 AAAAAAGCTGAGTTGGAGAGAGG - Intronic
1066388844 10:34962786-34962808 GAATAAGCACAGAAGAAGGGTGG - Intergenic
1066392039 10:34985232-34985254 AAATAACCACATATGGCTAGTGG + Intergenic
1067011631 10:42719839-42719861 AATAAAGCACAGAAGGATAGAGG - Intergenic
1067310977 10:45113331-45113353 AAAATAGAACAGATGGAGACAGG - Intergenic
1067550291 10:47229577-47229599 AAATAAGCAGAAATGGAGCCAGG + Intergenic
1070409516 10:76126577-76126599 ACAGAAGCCCAGATGTAGAGAGG - Intronic
1070739748 10:78894942-78894964 AAACAAGCACAGATGCAAACAGG + Intergenic
1071253512 10:83844776-83844798 AAATGAGAACAGATGGACAAGGG - Intergenic
1071357175 10:84809994-84810016 AAATGAGAACACATGGACAGAGG - Intergenic
1071431555 10:85610922-85610944 GAATGAGGACACATGGAGAGAGG - Intronic
1072363705 10:94687185-94687207 TAATCACCACAGAAGGAGAGTGG - Intronic
1072410433 10:95197209-95197231 AAATACCCACAGATGTGGAGGGG - Intronic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073382487 10:103090128-103090150 AAATTGGAAAAGATGGAGAGGGG + Exonic
1073956919 10:108883162-108883184 CTAGAAGCTCAGATGGAGAGGGG + Intergenic
1074333214 10:112541316-112541338 ATATAAGAACACATGCAGAGAGG - Intronic
1074670509 10:115785125-115785147 ACATATCCACCGATGGAGAGGGG - Intronic
1074801583 10:117005547-117005569 AAAGAACCACAGAGGTAGAGCGG + Exonic
1075474272 10:122719801-122719823 AAAAAGGCATAGAAGGAGAGAGG - Intergenic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078545358 11:12243001-12243023 AAGTAAACACAGATCGAGAAAGG + Intronic
1078721078 11:13883655-13883677 AAACAAGCACAACGGGAGAGTGG + Intergenic
1078811191 11:14765644-14765666 ATATTAGCACAGAAGGAAAGAGG + Intronic
1078954659 11:16177964-16177986 AGATAAGCACAGATAGAGAAGGG + Intronic
1078991079 11:16647286-16647308 AAATTAGCAGAGAGGGAAAGGGG - Intronic
1079436564 11:20459396-20459418 AAATGAGCAGAAATGGAGGGGGG - Intronic
1079491328 11:20991950-20991972 AAAGAACCAAAGAAGGAGAGGGG - Intronic
1080210779 11:29782383-29782405 GAATAAGCACAGATGGATCCTGG + Intergenic
1081299436 11:41432614-41432636 AATTAAGGAAAGATGTAGAGAGG + Intronic
1083059336 11:59853147-59853169 AAAAATGCCCAAATGGAGAGGGG - Intronic
1084040365 11:66539235-66539257 AACTATGCAAAGATGGAGGGAGG + Exonic
1084352379 11:68611553-68611575 AAAGAAGGACAGATGGATAAAGG - Intronic
1084383748 11:68829339-68829361 AGAAAATCACAGAAGGAGAGGGG - Intronic
1084756543 11:71242602-71242624 AAATAAGCAGTGATGTAGTGTGG - Intronic
1086554952 11:88098330-88098352 AAATAAACACAGACTTAGAGAGG - Intergenic
1087184709 11:95176558-95176580 AAATGGGCACAGATGTAGACAGG + Intronic
1087285644 11:96262432-96262454 AAATAAGAACAAATGGTGACTGG - Intronic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1090509810 11:127363147-127363169 AGAAAAGCATAGATGGAGGGAGG + Intergenic
1090959680 11:131544955-131544977 AAATAATGACAGATTGAGAGGGG - Intronic
1091142451 11:133247202-133247224 AAATAATCACATATGAAGGGTGG + Intronic
1091181378 11:133607484-133607506 AAATAACAACAGAGAGAGAGAGG + Intergenic
1091761683 12:3091658-3091680 AAATAAGAACAAAGGCAGAGTGG + Intronic
1092021971 12:5210436-5210458 AAATGTGCACACATAGAGAGAGG - Intergenic
1092092760 12:5817270-5817292 AAGTAAGCTGAGATGCAGAGAGG + Intronic
1092942835 12:13426626-13426648 AAATAGGCACAGACAGGGAGGGG - Intergenic
1094293132 12:28874394-28874416 AAAAAAGCAAAGATTGAGAGAGG + Intergenic
1094382956 12:29863534-29863556 AAATAAGCAGAGAGGTAGAGAGG + Intergenic
1095046438 12:37512763-37512785 AAAAAAACACAGAGAGAGAGAGG - Intergenic
1096199770 12:49673300-49673322 AGATGAGCAAAGATGGAAAGTGG + Intronic
1098922463 12:76315105-76315127 AATTAAGCATAAATGGTGAGGGG - Intergenic
1099101575 12:78447920-78447942 CATTAAGCAGAGATTGAGAGAGG + Intergenic
1099264206 12:80424084-80424106 TAATCAGCACACATGGAGACAGG + Intronic
1099307574 12:80976953-80976975 CAATGAGCACACATGGAGACAGG - Intronic
1099718045 12:86322170-86322192 CAATAAGAACAGATGGACACAGG + Intronic
1100277097 12:93081315-93081337 ACATAAGCAGCGAAGGAGAGGGG + Intergenic
1100552797 12:95662205-95662227 AAGGAAGAACAGAAGGAGAGGGG - Intronic
1100669560 12:96795745-96795767 ACACAAGCACAGAAGTAGAGGGG - Intronic
1100758437 12:97777975-97777997 AAACAAGTCGAGATGGAGAGAGG - Intergenic
1101226051 12:102689135-102689157 AAAGAAGCTCGGATGCAGAGAGG - Intergenic
1102849717 12:116229133-116229155 AAATATACACAAATGGTGAGGGG + Intronic
1103196774 12:119050799-119050821 AAATAGCCACAGATGGCTAGTGG - Intronic
1103690912 12:122774053-122774075 CAAGAATCACAGATGAAGAGGGG - Intergenic
1103841606 12:123869725-123869747 AGATAAACTCAGATGGAGCGAGG - Intronic
1104119824 12:125788691-125788713 ATAGCAGCAGAGATGGAGAGAGG + Intergenic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1104514320 12:129410207-129410229 AAATGACCACAGAGGGACAGGGG + Intronic
1104652039 12:130542140-130542162 AAGTAAGCACAAAGAGAGAGGGG + Intronic
1104745755 12:131209446-131209468 CAACAACCACAAATGGAGAGTGG + Intergenic
1105849089 13:24318664-24318686 ACACAAGCGCAGGTGGAGAGAGG - Intronic
1106822936 13:33486602-33486624 CAATAAGGAAAGATGGAAAGAGG - Intergenic
1107203145 13:37747015-37747037 AGAAAAGCACAGATGAAAAGAGG - Intronic
1107232260 13:38124094-38124116 CAATAAGCACACATGGACACAGG - Intergenic
1107949640 13:45450507-45450529 AAATATTTACAGAAGGAGAGTGG + Intergenic
1108121991 13:47198266-47198288 AAATATGTACATATGGTGAGGGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109582046 13:64352956-64352978 AAATAAACATATATAGAGAGAGG - Intergenic
1110231377 13:73170815-73170837 AAATAATCACATTGGGAGAGTGG - Intergenic
1110899820 13:80808213-80808235 AAATAAGTGCACATGGAGATAGG - Intergenic
1111025753 13:82520380-82520402 AACTAAGAATAGATAGAGAGAGG + Intergenic
1111089306 13:83421994-83422016 AAATATGTACAGAAAGAGAGAGG + Intergenic
1111440089 13:88270810-88270832 AAATAATAACAGATGGGTAGAGG + Intergenic
1112819557 13:103315387-103315409 AGATAAGGAAATATGGAGAGAGG - Intergenic
1113053910 13:106246395-106246417 CCATAAGCACAGAGGGACAGAGG + Intergenic
1114006625 14:18320438-18320460 AAATACCCACAGATGTGGAGGGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1115727381 14:36231990-36232012 CAATGAGAACACATGGAGAGAGG - Intergenic
1116065221 14:39973261-39973283 AAATAAGCACACACCAAGAGAGG - Intergenic
1116615984 14:47139896-47139918 ATATATACACATATGGAGAGAGG + Intronic
1117056149 14:51913637-51913659 GAAGAAGCAGAGATGTAGAGAGG + Intronic
1117385361 14:55206905-55206927 AAATAAGCCCAGAGGTGGAGGGG - Intergenic
1117859920 14:60079233-60079255 AAATAAGAACACATGGACACAGG + Intergenic
1117931689 14:60849659-60849681 CACTAAGCACAGGTGGACAGTGG + Intronic
1118670767 14:68124136-68124158 TAATAAGCACATATGAAGATTGG + Intronic
1119104284 14:71909502-71909524 AAATAAGGACAGAGGGTGTGGGG + Intergenic
1119218629 14:72888634-72888656 TAACAAGGAAAGATGGAGAGTGG - Intronic
1119688137 14:76649357-76649379 AAAAGAGCACGGTTGGAGAGTGG - Intergenic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1122569144 14:102682874-102682896 AAAGTAGCACAGATAGTGAGTGG + Intronic
1123057250 14:105576767-105576789 ATATAAGGAGAGATAGAGAGAGG - Intergenic
1123753770 15:23380422-23380444 AAATAAACAAAGAAAGAGAGAGG + Intergenic
1126433289 15:48609624-48609646 AACCAACAACAGATGGAGAGTGG - Intronic
1126558380 15:50016512-50016534 AAAGAAGCACTGCTGGACAGAGG + Intronic
1127531653 15:59849253-59849275 AAAAAAGCACAGGTGGAGGCGGG + Intergenic
1128798945 15:70484870-70484892 AAATAATGAAAGATGAAGAGAGG + Intergenic
1128856959 15:71026111-71026133 AAATAAGAACACATGGACACAGG - Intronic
1129316353 15:74747596-74747618 AAATAAGCATTCATGGAGAATGG + Intergenic
1129494404 15:75964227-75964249 AAATAAACACAGAAGGAAAGGGG + Intronic
1130684772 15:86027344-86027366 AAAGAGGGACAGATGGAGGGAGG - Intergenic
1131843809 15:96467761-96467783 AAATAAGCAAAGATGGTGGGAGG + Intergenic
1132631705 16:920833-920855 AACGAGGGACAGATGGAGAGAGG + Intronic
1133431010 16:5736727-5736749 AGACACACACAGATGGAGAGAGG - Intergenic
1133708426 16:8377990-8378012 AAATAAGGAGTGATTGAGAGTGG + Intergenic
1134140082 16:11710864-11710886 CAATAAGCATAGATAGACAGGGG - Intronic
1134375025 16:13664156-13664178 GAATAAAGACAGATGGAGAGAGG - Intergenic
1134802895 16:17101684-17101706 AAATAGGGAAAGATTGAGAGAGG + Intergenic
1135046990 16:19164224-19164246 AAAGAACCAAAGATGGGGAGTGG - Intronic
1135109184 16:19677514-19677536 AGCTAGGCACAGATGGGGAGAGG + Intronic
1135145246 16:19956211-19956233 AAATGAGAACACATGGACAGAGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135534467 16:23282468-23282490 AAATAAGTACAGATAAAGAAAGG + Intronic
1135609898 16:23857348-23857370 GAATCAGCACAGAGGGAGGGAGG + Intronic
1135651748 16:24212435-24212457 AAAAAAGCACAGGAGGAGAGAGG - Intronic
1135968616 16:27055819-27055841 AAAAAAGGACAGCTGGTGAGGGG - Intergenic
1137346939 16:47671185-47671207 TAATAATGACAGATGGAGAAAGG - Intronic
1137483257 16:48870110-48870132 AAATAGGCACAGATGGTAGGTGG + Intergenic
1138218991 16:55234100-55234122 ATATATGCACACATAGAGAGAGG - Intergenic
1138222375 16:55263585-55263607 AGATAAACAGAGACGGAGAGAGG - Intergenic
1138354371 16:56365786-56365808 AGATTAGAACAGAGGGAGAGTGG + Intronic
1138909122 16:61375142-61375164 AAATACGCACATATGGGCAGGGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1140685873 16:77433999-77434021 AAATGAGGAAAGATGGAGAGAGG + Intronic
1140771043 16:78204347-78204369 AAATAATCACATATGAAGAATGG + Intronic
1141986479 16:87583747-87583769 CAAGAAGCACAGTGGGAGAGTGG + Intergenic
1144198383 17:12917250-12917272 ACATAATCACAGAGGGGGAGAGG + Intronic
1145279476 17:21457242-21457264 AAATCAGCACAGCAGGAGGGAGG + Intergenic
1145769005 17:27479107-27479129 ACAGGAGCACAGAGGGAGAGAGG - Intronic
1146040151 17:29445201-29445223 CAATAAGCACATATGAAGAATGG + Intronic
1146469527 17:33112676-33112698 AATTCAGGACAGATGTAGAGAGG - Intronic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147863884 17:43540676-43540698 AAATAGGCACATTTGGATAGAGG + Intronic
1149037241 17:52148663-52148685 TAATAAGGAGCGATGGAGAGTGG - Intronic
1149807700 17:59634564-59634586 AAGCAACCACAGTTGGAGAGAGG - Intronic
1150620601 17:66804979-66805001 AAATAAGCACAAAAGGGGAGAGG - Exonic
1150722986 17:67629113-67629135 AACTAAGCACGGATGAAGGGGGG - Intronic
1151140444 17:71986405-71986427 ATCAAAGTACAGATGGAGAGTGG - Intergenic
1153141974 18:1983129-1983151 AAAGAAGCAAAGATGAAGAGAGG - Intergenic
1153603014 18:6800656-6800678 CAATAAGAACACATGGACAGAGG + Intronic
1153987817 18:10368715-10368737 AAGAAAGGAGAGATGGAGAGAGG + Intergenic
1154086922 18:11314454-11314476 AAATACTCAGAGATGGAGAAGGG + Intergenic
1155327237 18:24677003-24677025 AAAGGAGGACTGATGGAGAGTGG + Intergenic
1156030869 18:32710771-32710793 AGAAATGGACAGATGGAGAGGGG + Intronic
1156613596 18:38756341-38756363 AAATGAGGACTGGTGGAGAGGGG + Intergenic
1156792304 18:40990363-40990385 ACAAAAGGAGAGATGGAGAGAGG + Intergenic
1157506989 18:48233743-48233765 AAAAAAGCACAGATGAATATGGG - Intronic
1159170499 18:64760068-64760090 AAATAACCACATATTGATAGTGG + Intergenic
1159423035 18:68248071-68248093 AAATAAGAACACATGGACACAGG - Intergenic
1160244395 18:77145490-77145512 GAAGCAGGACAGATGGAGAGAGG - Intergenic
1161376404 19:3941238-3941260 AAAAAAAAAAAGATGGAGAGGGG - Intronic
1161455977 19:4369886-4369908 AAACCAGCACAGATGGACACAGG + Intronic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1162858082 19:13484446-13484468 AAAGAAACAGAGATAGAGAGAGG + Intronic
1166822318 19:45588001-45588023 ACACAAGCAGAGATGGGGAGGGG + Intronic
1167155859 19:47738624-47738646 AAATAAGCACATGTGGCTAGTGG + Intronic
1167390815 19:49193783-49193805 AAAGAAGGTCAGATGCAGAGAGG - Intronic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
1168581274 19:57557665-57557687 AAATACCCACAGGTGTAGAGGGG + Intronic
926619499 2:15034293-15034315 AAAGAAAGAAAGATGGAGAGAGG + Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
926795812 2:16617984-16618006 AAATAAATAAAGAGGGAGAGAGG - Intronic
927553834 2:24019139-24019161 AAACAAGCACAGGTCGAGCGCGG - Intronic
928054761 2:28041723-28041745 AATTGAGCAAAGATGGAAAGAGG - Intronic
928307751 2:30184617-30184639 CCAACAGCACAGATGGAGAGAGG - Intergenic
928364361 2:30690048-30690070 AACTCAGCACAGAAGGGGAGAGG - Intergenic
928781318 2:34824809-34824831 AAATAAGATGAGATGGAGACAGG + Intergenic
929315102 2:40467427-40467449 TATTCAGTACAGATGGAGAGAGG + Intronic
930284061 2:49405890-49405912 AAAGAAGTACAGATGGCCAGGGG - Intergenic
930322338 2:49871907-49871929 AAATAAGAAAAGAGGGAGAGGGG - Intergenic
930333287 2:50014126-50014148 AAATGAGTATGGATGGAGAGAGG + Intronic
930601858 2:53453001-53453023 AAATTAGAAAGGATGGAGAGAGG + Intergenic
930798928 2:55421959-55421981 AAATACAGACAGAAGGAGAGTGG + Intergenic
931146753 2:59527753-59527775 AAAGGAGCACAGATGGAATGAGG - Intergenic
932355235 2:71062951-71062973 AAATAAGTGTACATGGAGAGAGG - Intergenic
932537399 2:72614026-72614048 ACAAAAGCACAGTTGGATAGTGG + Intronic
932925418 2:75967715-75967737 AAAGAAGGACAGAGAGAGAGAGG - Intergenic
933771149 2:85744981-85745003 AGATCAGCACAGCTGGAGGGAGG - Intergenic
935132443 2:100270771-100270793 AAATACTCACAGGTGTAGAGGGG + Intergenic
935136458 2:100307561-100307583 AAATTAGCTCAGAAGAAGAGTGG + Intronic
935554720 2:104496762-104496784 AAATAGACACAGATAGAGAAGGG - Intergenic
935555002 2:104499740-104499762 AATTAAGCAAAGATGCAGGGAGG + Intergenic
936052547 2:109235772-109235794 AAATAAGAACAGGGAGAGAGGGG - Intronic
936723135 2:115278307-115278329 GAAAAAGCACAGAAGGACAGTGG - Intronic
938789045 2:134660376-134660398 AAAGCAGCAGAGAGGGAGAGGGG + Intronic
939172377 2:138710921-138710943 ACATTAGCACAGATGCTGAGTGG - Intronic
939547302 2:143569384-143569406 AGAGAAGAACAGATGGAGACGGG + Intronic
940391658 2:153139576-153139598 AGATATGAACAGATGGAGATGGG + Intergenic
941348594 2:164402730-164402752 AAATAAGCCATGATGGAGAATGG - Intergenic
941466985 2:165839559-165839581 AAGGAAGCAGAGATGGAGGGAGG + Intergenic
941708383 2:168684635-168684657 AAATAAGCAAAGATGTTGAGAGG + Intronic
942161221 2:173189988-173190010 AAATGAGCAAAGGTGCAGAGGGG - Intronic
942492254 2:176501159-176501181 AAAAAAGCAGAGAGGGAGGGCGG - Intergenic
942720533 2:178947666-178947688 AAGTCAGCAAAGATGCAGAGAGG + Intronic
942858535 2:180581957-180581979 CAATAAGCACATATGGCTAGTGG + Intergenic
943203643 2:184861470-184861492 AAATGAGTACAGAAGGAAAGAGG - Intronic
943438428 2:187896310-187896332 GAATAAGCAGAGATAGAGAGGGG + Intergenic
944326049 2:198404939-198404961 CAATAAGAAGAGATGAAGAGGGG - Intronic
945541299 2:211090454-211090476 AAATAATCAAATATTGAGAGTGG + Intergenic
945541570 2:211093707-211093729 AACTAAGAAAAGATGGAGATAGG + Intergenic
946226388 2:218266152-218266174 AGAGAGGCACAGATGAAGAGAGG + Intronic
946482884 2:220073794-220073816 ATAATAGCACAGATGGAAAGGGG + Intergenic
947079999 2:226385485-226385507 AAAAAAGCACAGTTGGAGGATGG - Intergenic
947159083 2:227193865-227193887 AAATAAGGAGAGAGGGAGGGAGG + Intronic
947159100 2:227193932-227193954 AAATAAGGAGAGAGGGAGGGAGG + Intronic
947354370 2:229276758-229276780 AAGTCAGCTCAGATGGAGAAAGG - Intergenic
947766884 2:232643644-232643666 AAAAAAACACAGATGGACATTGG - Intronic
948447542 2:238044584-238044606 AAATAAGCGGGGATGGGGAGTGG - Intronic
1169845335 20:9985184-9985206 TAAGTAGCACAGATTGAGAGTGG - Intergenic
1169873429 20:10271368-10271390 TAATAAGAACGGCTGGAGAGTGG - Intronic
1170096606 20:12652203-12652225 CAATAATAACAGATGTAGAGAGG - Intergenic
1170538017 20:17361002-17361024 AAATAGGCACATATGGCTAGTGG - Intronic
1171135661 20:22692323-22692345 ATCTCAGCACTGATGGAGAGAGG - Intergenic
1171773224 20:29343184-29343206 AAATGAGAACACATGGACAGAGG + Intergenic
1171780574 20:29413599-29413621 AGAAAAGGACAGATGGACAGAGG - Intergenic
1172257633 20:33533675-33533697 AAAAAAGCACAGATGGGAACCGG + Intronic
1172501322 20:35430043-35430065 AAAGTAGCTCAGCTGGAGAGTGG + Intergenic
1172840222 20:37898389-37898411 GAACAAGCCCAGAGGGAGAGGGG - Intergenic
1172942672 20:38665294-38665316 AAATAAACACAGAAGGCAAGGGG + Intergenic
1173444142 20:43102810-43102832 AAGAAACCACAGCTGGAGAGAGG - Intronic
1173850926 20:46217095-46217117 AATTAAGCTCAGGAGGAGAGTGG + Intronic
1174081201 20:47971893-47971915 ACAGAGGCACTGATGGAGAGAGG - Intergenic
1174365955 20:50056548-50056570 AAACAAGGACAGTTGCAGAGAGG - Intergenic
1174367466 20:50065207-50065229 AAAGATGCACAGCTGGGGAGTGG - Intergenic
1174561045 20:51431079-51431101 AAATAAGCACATATAGAGAATGG - Intronic
1176925053 21:14738631-14738653 AAATAAGAACACATGGACACAGG - Intergenic
1177926630 21:27224139-27224161 AAATAAGCACAGATGTAACAAGG + Intergenic
1177928081 21:27244028-27244050 CAGTAAGAACACATGGAGAGTGG + Intergenic
1178003255 21:28188277-28188299 AAATAAGCACTTATGAAGAATGG + Intergenic
1179048901 21:37871712-37871734 AGATAAACAGTGATGGAGAGAGG + Intronic
1179433041 21:41338151-41338173 AAATAAGCAAAGAAGGAGAGGGG - Intronic
1179475030 21:41637544-41637566 AAATAAGAAAAGAGGGAGAGAGG - Intergenic
1179585299 21:42370587-42370609 AAATTAACCCAGAAGGAGAGGGG + Intergenic
1179722687 21:43324559-43324581 ACAGAGGCACAGATGGGGAGAGG - Intergenic
1180431134 22:15251249-15251271 AAATACCCACAGATGTGGAGGGG + Intergenic
1180923804 22:19538244-19538266 AAAGAAGGAGAGACGGAGAGAGG + Intergenic
1180995556 22:19963518-19963540 AGGTGAGCACAGGTGGAGAGAGG - Intronic
1182000564 22:26916269-26916291 AACCAAGGACAGATGGAGAGTGG + Intergenic
1182411006 22:30186342-30186364 AAAAAAGGACAGAAGGAGGGAGG - Intergenic
1182751707 22:32646821-32646843 ACAGAACCACAGAGGGAGAGGGG - Intronic
1183012849 22:34961496-34961518 AAACAAGAACAGAAAGAGAGAGG + Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
949375698 3:3387639-3387661 TAATAGGCACAAATGAAGAGAGG + Intergenic
949589689 3:5481332-5481354 AAAAAAGGACAAACGGAGAGAGG + Intergenic
949804754 3:7942660-7942682 AAATACCCACAGATGTGGAGGGG + Intergenic
950278999 3:11689826-11689848 AAACAAGCACGGAGGCAGAGTGG + Intronic
950704036 3:14769168-14769190 TAATAAGCACGGAGGCAGAGGGG + Intronic
951015144 3:17723225-17723247 AAATAATCACACATAGAGAATGG - Intronic
951201649 3:19881850-19881872 CCATAAGCACAGATGTAGACAGG + Intronic
951580657 3:24159393-24159415 AAATAAGCAAACATGATGAGGGG + Intronic
953127588 3:40106600-40106622 AAATAAGAACAGAAGGAAAGTGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953422612 3:42766098-42766120 AACTATGCAGAGAAGGAGAGGGG + Intronic
953485607 3:43291728-43291750 TATTAAGCACATATGCAGAGTGG - Intronic
953496605 3:43393007-43393029 AAATAGGCACAGATGGCCACAGG + Intronic
954091483 3:48287804-48287826 ACATAAGCACAGATGGAGATAGG + Intronic
954539410 3:51383894-51383916 AAATAAGCACAGAATGCGGGAGG - Exonic
954581932 3:51707603-51707625 AGACCAGCACAGATGGAGACAGG - Intronic
955948771 3:64221233-64221255 AAAAAAGCAAGGCTGGAGAGAGG - Intronic
956032988 3:65059671-65059693 AAATAAGAACACTTGGAGACAGG + Intergenic
956517348 3:70063639-70063661 AAGTCAGCAAAGATGGAGACAGG - Intergenic
957084442 3:75667669-75667691 AGAAAAGGACAGATGGACAGAGG + Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
957387670 3:79518407-79518429 AAAGAAGCACGGAGGGAGGGAGG - Intronic
957455233 3:80433349-80433371 AGATAAGCAAAATTGGAGAGTGG - Intergenic
958027703 3:88068202-88068224 AAATAAGCACTGATGAACAAAGG - Intronic
958129174 3:89395751-89395773 GAATAAGAACAGAGGGAGAAGGG - Intronic
958557784 3:95702690-95702712 AAATAAAGACAGATGGATACTGG - Intergenic
959625238 3:108442321-108442343 AAAGAAGCACAGATGGAGAGAGG + Intronic
959631807 3:108515229-108515251 CAAAGAGCCCAGATGGAGAGTGG - Intronic
959674725 3:109021372-109021394 ACATCAGCAGAGATGGAGAGAGG - Intronic
961027761 3:123575059-123575081 AAATAGGCACATATGGCTAGTGG - Intronic
961574215 3:127822077-127822099 AAATAAACACAGATGGGAAGGGG - Intronic
962426592 3:135274107-135274129 AAAGAAGAAAAGTTGGAGAGTGG + Intergenic
963700229 3:148616992-148617014 AAATGAGAACACATGGAGACAGG - Intergenic
964211797 3:154236672-154236694 AAATAAGCAGAGATGGGAAACGG + Intronic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
965039061 3:163482756-163482778 AGGGAAGCACAGAGGGAGAGGGG - Intergenic
966012218 3:175094619-175094641 AAACAAGAAGAGATGGAGGGAGG + Intronic
966771824 3:183510937-183510959 AAATACCCACAGGTGTAGAGGGG - Intronic
966852135 3:184170807-184170829 AAAGACGGACGGATGGAGAGAGG - Exonic
967427531 3:189344600-189344622 AAATAAGTACAGATGTTCAGGGG - Intergenic
967528345 3:190520051-190520073 AATGAATCTCAGATGGAGAGGGG + Intronic
967770716 3:193330728-193330750 AAAGAAGCAGAGGAGGAGAGAGG + Intronic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968505765 4:970715-970737 AAGGGAGCACAGATGTAGAGAGG - Intronic
970860463 4:20696762-20696784 CAATAACCACAGATGGCTAGTGG - Intronic
970973128 4:22008447-22008469 AAATGAGCACAGATGAATACAGG + Intergenic
971012739 4:22456682-22456704 ACATGATCACAGAGGGAGAGAGG - Intronic
971034655 4:22679956-22679978 AAATAAGACCACATGAAGAGTGG - Intergenic
973709230 4:53611545-53611567 AAATAAGTAGAGATGGAGTAAGG + Intronic
973767443 4:54176059-54176081 CTAGAAGGACAGATGGAGAGAGG + Intronic
974006083 4:56558672-56558694 ATAACAGCTCAGATGGAGAGAGG - Intronic
974272276 4:59665945-59665967 ATATTAGCACAGCTTGAGAGTGG - Intergenic
974545179 4:63295813-63295835 AAATAAGAATAGATGGATAAAGG - Intergenic
974822217 4:67081745-67081767 AAATAAGCACACTAGGAAAGAGG - Intergenic
974875205 4:67695242-67695264 TAATAAGCAAAAAGGGAGAGTGG - Intronic
975476898 4:74833854-74833876 AAATCAACACAGCTGGAAAGTGG - Intergenic
976465950 4:85368834-85368856 AAATAAGAAAATAGGGAGAGGGG + Intergenic
976764360 4:88583666-88583688 ACAGAATCACAGGTGGAGAGGGG + Intronic
977257422 4:94756956-94756978 AAATAAGTAATGCTGGAGAGTGG + Intergenic
978277180 4:106966425-106966447 AATTTAGAAGAGATGGAGAGTGG - Intronic
978295355 4:107198640-107198662 TAATAGGCACAGATGGTGTGGGG + Intronic
979153423 4:117350526-117350548 AAATAAGAACATATAGAGTGTGG + Intergenic
980032689 4:127848580-127848602 AAAAAAGAAAAGAAGGAGAGAGG + Intergenic
980143981 4:128957990-128958012 AGAGAAGGACAGATAGAGAGGGG - Intronic
980282346 4:130737624-130737646 CACCCAGCACAGATGGAGAGTGG - Intergenic
980451562 4:132979953-132979975 AAATGAGAACACATGGACAGAGG - Intergenic
980453207 4:133003414-133003436 AAATGAGAACACATGGACAGAGG + Intergenic
981435590 4:144717781-144717803 AAATAAACACTGGGGGAGAGGGG - Intronic
981520552 4:145657406-145657428 ATATAATCACAGATGGGGAGAGG - Exonic
981946290 4:150347951-150347973 AAATAGGCACAGATGACTAGAGG - Intronic
981958550 4:150508025-150508047 AAATAAGAACACATGGACACAGG + Intronic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
983288170 4:165765819-165765841 AAATAGGGATAGATGGAGAGAGG + Intergenic
984270036 4:177538380-177538402 AAATGAGAACACATGGACAGAGG + Intergenic
984602598 4:181745606-181745628 AAGTAAGCACAAATGCAGAAAGG + Intergenic
986504677 5:8436924-8436946 AAATAAAGACAAATGGAGATTGG - Intergenic
986571356 5:9169380-9169402 TAATAAGCAAGCATGGAGAGAGG - Intronic
987283119 5:16430235-16430257 GAATTATCACAGATGGGGAGAGG - Intergenic
989447037 5:41542018-41542040 AAATATGCCCAGGTGGTGAGTGG + Intergenic
990011100 5:50999210-50999232 AAATAATCAAAGATGAAGAATGG - Intergenic
991628801 5:68632914-68632936 AAAAAAGAAAAGAGGGAGAGAGG + Intergenic
992022811 5:72641184-72641206 AAATAAGAACAGGTTCAGAGAGG + Intergenic
992167365 5:74067848-74067870 AAAAAAGCACCCATGGAGAAGGG - Intergenic
992644846 5:78802522-78802544 CAATAGGGACAGATAGAGAGTGG + Intronic
992758294 5:79929808-79929830 AACTAAGCAGGGATGGAGAATGG + Intergenic
993104659 5:83586338-83586360 AATCAGGCAAAGATGGAGAGTGG - Intergenic
994091313 5:95811964-95811986 AAATACCCACAGGTGTAGAGGGG + Intronic
994166505 5:96614720-96614742 AAAAAAGCACTGAGGAAGAGGGG - Intronic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996145098 5:119965136-119965158 ATAGAAGGACAGCTGGAGAGGGG - Intergenic
996923551 5:128796773-128796795 AACTAGGCACAGGTGGAGAAGGG - Intronic
997173538 5:131750302-131750324 AAAAACGCAAAGAAGGAGAGTGG + Intronic
998791776 5:145773577-145773599 AATTAAGCACAGATGGACTAAGG - Intronic
998812641 5:145981789-145981811 CAATAACCACAGATGGGCAGTGG + Intronic
999030429 5:148284322-148284344 AAAGAAGGAAAGAGGGAGAGAGG - Intronic
1000142824 5:158423003-158423025 AGAGAAGCAAAGATGAAGAGTGG + Intergenic
1000177938 5:158776634-158776656 AAAGAACCACAGGTGGAGTGCGG - Intronic
1000553968 5:162700736-162700758 AAATAAGAAAAGAGGGAGGGAGG + Intergenic
1000983755 5:167844951-167844973 AATTCAGCATAGAGGGAGAGAGG - Intronic
1001268255 5:170291029-170291051 AAAGAAAGAGAGATGGAGAGAGG + Intronic
1002628929 5:180555440-180555462 AAATAAACACAGATGTCTAGAGG - Intronic
1004974629 6:20950987-20951009 AGAAAAGAAAAGATGGAGAGTGG + Intronic
1007927891 6:45664396-45664418 AACTAAGCACAGAGAGAAAGGGG - Intergenic
1009865083 6:69387300-69387322 AGAGAAGCAGAGAGGGAGAGAGG + Intronic
1010226989 6:73499332-73499354 AAATAACCACAATTGGCGAGTGG - Intronic
1010470741 6:76225181-76225203 AACTGAGCCCATATGGAGAGAGG + Intergenic
1010615821 6:78010942-78010964 AAAGAAGGAGAGAGGGAGAGAGG - Intergenic
1010733353 6:79413776-79413798 AAATAAGAACAGATTCAGAGTGG - Intergenic
1011507399 6:88061456-88061478 ACACAAACACAGATGGAAAGTGG + Intronic
1012439087 6:99245704-99245726 AAATAAGAAGAGCTGGAAAGAGG + Intergenic
1012898260 6:104976719-104976741 AAATGAGCAAAGATGTGGAGAGG + Intronic
1012958841 6:105600743-105600765 AAAGAAGCACAGATAGGGATTGG - Intergenic
1013284431 6:108668694-108668716 GCAAAAGCCCAGATGGAGAGGGG + Intronic
1013629934 6:111976556-111976578 AAATATACACAGTTAGAGAGAGG - Intergenic
1013962018 6:115912026-115912048 AAATAAGCAAGGAAGGAAAGGGG - Intergenic
1014083203 6:117312099-117312121 ACGGAAGCACAGATTGAGAGAGG - Intronic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015821551 6:137266648-137266670 AAATACACACAAATGGAGAGAGG + Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1021931956 7:25589893-25589915 AGAAAAGTACAGATGCAGAGAGG - Intergenic
1023195679 7:37636186-37636208 AAATAAGTACAGGGGGAGGGAGG - Intergenic
1025973015 7:66345608-66345630 AAAAAAACACCTATGGAGAGTGG + Intronic
1026162461 7:67881546-67881568 AAATACCCACAGGTGTAGAGGGG - Intergenic
1026178271 7:68016569-68016591 AAAGAAGGACAGAAGGAGGGAGG - Intergenic
1026398901 7:69988944-69988966 AGAAAAGTACAGATGGAAAGGGG + Intronic
1027376201 7:77552834-77552856 AAAGAAGCTAAGATTGAGAGTGG - Intronic
1027782408 7:82535766-82535788 AACTAATCTCTGATGGAGAGGGG + Intergenic
1027830263 7:83168004-83168026 AAAAATGCACAGATGGATAGAGG - Intergenic
1028566134 7:92233310-92233332 AAATAAGCTGAGATGCAGAGAGG + Intronic
1029789800 7:102830315-102830337 AAGCAGGCACAGATGGAGACTGG - Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031196150 7:118616569-118616591 AAGAAAGCACGGATGGGGAGAGG + Intergenic
1031396285 7:121278262-121278284 AAAGAAGGACAGTTGGAGAAAGG + Intronic
1031986077 7:128165670-128165692 AAACAAGCACAGAGAGAGGGAGG + Intergenic
1032237368 7:130137106-130137128 AAATAACCACACATGGCTAGTGG + Intergenic
1032540525 7:132699405-132699427 TAATAAGCACAGTTAGAAAGAGG + Intronic
1032954206 7:136951555-136951577 AAATAAGAAAAGAGGGAGTGAGG + Intronic
1033134778 7:138775268-138775290 AAATAATCAGAGGTGGGGAGGGG - Intronic
1033954191 7:146824080-146824102 AAATGAGAACAGATGGACACAGG - Intronic
1034070418 7:148179504-148179526 AAAGAAAGACAGAGGGAGAGAGG + Intronic
1034096800 7:148416273-148416295 CAATCAGCACAACTGGAGAGAGG + Exonic
1036080036 8:5545133-5545155 ACAGAGGCACAGATGGGGAGTGG - Intergenic
1036093819 8:5700940-5700962 AAATTATCAGGGATGGAGAGAGG - Intergenic
1036212884 8:6856736-6856758 AAATAAGCCCAGATGGATTTAGG + Intergenic
1036219076 8:6905814-6905836 AAATAAGCACAGAATGAGTGTGG + Intergenic
1037916540 8:22776589-22776611 AGATAAGCAAAAATGCAGAGAGG - Intronic
1038008266 8:23452471-23452493 AAATAACCACACATGGCAAGTGG - Intronic
1039250180 8:35654956-35654978 AATGATGCACAGATGGAAAGTGG + Intronic
1039374060 8:37015468-37015490 AGATAGGCACAGAGGAAGAGAGG - Intergenic
1039828898 8:41197305-41197327 AAATAATCACAGATGCTGAGAGG + Intergenic
1039935087 8:42036053-42036075 AAATAAGCACAGATGTATTTAGG + Intronic
1039988675 8:42469100-42469122 AATTAAGGACAGAGGGAAAGAGG + Intronic
1041092912 8:54319290-54319312 ATACAAGAACAGATGGACAGTGG + Intergenic
1041338398 8:56813484-56813506 AAAATAGCACAGAGTGAGAGTGG + Intergenic
1041389213 8:57334149-57334171 AAGGAAGCACAGACGGAGAATGG - Intergenic
1041980076 8:63847401-63847423 AATTAAGAACAAATGAAGAGTGG + Intergenic
1042218794 8:66453167-66453189 AGATAAGGAGAGATGGACAGAGG + Intronic
1044614639 8:94127138-94127160 AAATAAAAACAGAGGCAGAGCGG + Intergenic
1045725136 8:105163473-105163495 AAAAAAGAAGAGAGGGAGAGAGG - Intronic
1045958913 8:107943910-107943932 AAAGAAGAACAGAGGGAGAGGGG + Intronic
1046130564 8:109962815-109962837 TAATAGGCACAGATGGAGGTAGG + Intergenic
1046139921 8:110078134-110078156 AAAAAATCACTGATGCAGAGAGG + Intergenic
1046345108 8:112913650-112913672 AAAGAAAAACAGAGGGAGAGGGG - Intronic
1046495233 8:115005487-115005509 AAATAGAGAGAGATGGAGAGAGG - Intergenic
1047888403 8:129279003-129279025 AGATAAACACAGATGCTGAGTGG + Intergenic
1047892972 8:129333518-129333540 AAAGAAGCACAAGAGGAGAGAGG + Intergenic
1048090161 8:131231807-131231829 AAATAAGAACACATGGAAACAGG - Intergenic
1048233480 8:132666969-132666991 AAGCAAGCTCAGAAGGAGAGAGG + Intronic
1048512991 8:135079222-135079244 AGCTAAACACTGATGGAGAGAGG + Intergenic
1049780773 8:144427892-144427914 AGATAAACTCAGACGGAGAGGGG + Intronic
1050125606 9:2353677-2353699 AAACAAGCACACAAGGAGAAAGG - Intergenic
1050511540 9:6401344-6401366 AAATAGGCTCAGTGGGAGAGGGG - Intergenic
1050658743 9:7859319-7859341 AGATCAGCAAAGATGGACAGTGG + Intronic
1051054009 9:12962032-12962054 AAATTAGCACAGTTTGAAAGAGG - Intergenic
1051457293 9:17272890-17272912 AAATAAGGGCAGAAGGAGGGAGG - Intronic
1052410750 9:28118028-28118050 AAATAAGAACACATGGACATAGG + Intronic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1052842638 9:33306080-33306102 AAAAAAGCACAGAGGCAGGGAGG + Intronic
1053025994 9:34728816-34728838 AAATAAGCAGAGAAGGAAAATGG - Intronic
1053037500 9:34837856-34837878 AAATAAGCAGAGAAGGAAAATGG - Intergenic
1055296622 9:74839944-74839966 AAAAAAGAAAAGAGGGAGAGAGG + Intronic
1055837028 9:80455739-80455761 ACATAAGCAGAGATGGGGATAGG + Intergenic
1057394687 9:94669335-94669357 AAACTTGCACAGATGGGGAGGGG + Intergenic
1057583702 9:96310569-96310591 AAATAACCACATATGGCCAGTGG - Intergenic
1057961011 9:99457386-99457408 AAAGAAGCACAAGTGGAGAATGG + Intergenic
1057974999 9:99596022-99596044 AAATGAGCACTGACGGAGAAGGG - Intergenic
1058461046 9:105183074-105183096 AAAAAACAACAGATGGGGAGAGG - Intergenic
1058894611 9:109388497-109388519 AAATGAGCTCAGGTGCAGAGTGG + Intronic
1059016300 9:110519697-110519719 AAACAAGCCCTGATGGAGAGTGG + Intronic
1059388949 9:113986790-113986812 AACTGAGCAAAGATAGAGAGGGG - Intronic
1060591722 9:124821046-124821068 AGATCTGCACAGATGGTGAGGGG - Intergenic
1062494765 9:136826530-136826552 AACAAAGCACAGGTGGAGGGAGG - Intronic
1185543525 X:922916-922938 AAATAAGTAGAGAGAGAGAGAGG - Intergenic
1186623970 X:11272212-11272234 AAATTACCACAGGTGGATAGTGG + Intronic
1187007132 X:15243509-15243531 AAATATGCACAAATGGCTAGTGG - Intronic
1187258898 X:17667298-17667320 CCAGAAGCACAAATGGAGAGAGG + Intronic
1188023695 X:25186575-25186597 AAATTAGCACACATGGTGGGAGG - Intergenic
1188169720 X:26910065-26910087 GAAAAAGCACAGATATAGAGAGG + Intergenic
1188943507 X:36267283-36267305 AAATAAGCTAGGATAGAGAGGGG - Intronic
1189660726 X:43295382-43295404 ATAGAAGCACAGAAGGAGAATGG + Intergenic
1190411627 X:50141871-50141893 AAACAAGCCCTGATGGAGATGGG + Intergenic
1190642290 X:52492435-52492457 AAATAAGGACAAATGGAGCGAGG - Intergenic
1190645383 X:52520432-52520454 AAATAAGGACAAATGGAGCGAGG + Intronic
1190713359 X:53084899-53084921 AAACAAGGACAGATTGAGGGGGG - Intronic
1191110519 X:56800223-56800245 ATAGAAGCACAGATGAAGACAGG - Intergenic
1191872362 X:65759067-65759089 AAATTGGAACAGATGGTGAGGGG + Intergenic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192341418 X:70266803-70266825 AAATAAGCATACAAGAAGAGAGG + Intergenic
1193730410 X:85095843-85095865 AAAAAAAAAAAGATGGAGAGGGG + Intronic
1193786588 X:85767085-85767107 CAATGAGAACACATGGAGAGAGG - Intergenic
1194773908 X:97939275-97939297 GAAATTGCACAGATGGAGAGGGG - Intergenic
1194802502 X:98290330-98290352 AAATGAGCACAGGTGGAGTTTGG - Intergenic
1194938540 X:99980931-99980953 GTATAAGCATAGATGGAGTGAGG - Intergenic
1195527725 X:105911096-105911118 AATTAATCACAGAAGAAGAGAGG - Intronic
1196260870 X:113579693-113579715 AAACAAGAACAGATTGAGAATGG + Intergenic
1197105820 X:122714177-122714199 AAAAATGAACACATGGAGAGAGG + Intergenic
1197489002 X:127093068-127093090 AAATGAGAACAGAGGTAGAGAGG - Intergenic
1197956650 X:131957293-131957315 AAACAATCACAGAAAGAGAGTGG + Intergenic
1198167713 X:134073591-134073613 AAATAAGCAAGGAAGGAGATGGG + Intergenic
1198176847 X:134165020-134165042 AAATAATTCCAGATGGATAGAGG - Intergenic
1198865993 X:141123463-141123485 AAAAAAGAAGAGATGGTGAGTGG + Intergenic
1200413004 Y:2879920-2879942 AAGTAGGCAAAGAGGGAGAGGGG + Intronic
1200701043 Y:6402795-6402817 AAATAAGGTCAGATGGGGTGAGG - Intergenic
1200826375 Y:7648015-7648037 AAAGAGGGACAGAGGGAGAGGGG + Intergenic
1200914967 Y:8563572-8563594 AAATAAGGTCAGATGGGGTGAGG + Intergenic
1201033069 Y:9761903-9761925 AAATAAGGTCAGATGGGGTGAGG + Intergenic
1202082760 Y:21101722-21101744 AAATAAGAACAGAAGTTGAGTGG + Intergenic
1202110857 Y:21417902-21417924 AAGTGAGGACAGAGGGAGAGGGG + Intergenic
1202182275 Y:22149779-22149801 CAATAAGGTCAGATGGAGTGAGG - Intergenic
1202209085 Y:22436623-22436645 CAATAAGGTCAGATGGAGTGAGG + Intergenic