ID: 1030811864

View in Genome Browser
Species Human (GRCh38)
Location 7:113982349-113982371
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030811857_1030811864 27 Left 1030811857 7:113982299-113982321 CCACAGTGCTAACAAGTGACAGA 0: 1
1: 0
2: 1
3: 33
4: 279
Right 1030811864 7:113982349-113982371 AGTAAGGTATGATGGGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr