ID: 1030815263

View in Genome Browser
Species Human (GRCh38)
Location 7:114028338-114028360
Sequence CATAATCTAGCATGTTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030815257_1030815263 24 Left 1030815257 7:114028291-114028313 CCTGAAAAAAAAGAAAATCAAAT 0: 1
1: 0
2: 43
3: 635
4: 6639
Right 1030815263 7:114028338-114028360 CATAATCTAGCATGTTTGGGAGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030815263 Original CRISPR CATAATCTAGCATGTTTGGG AGG Intronic
901459080 1:9380861-9380883 TATAATCATGCCTGTTTGGGAGG - Intergenic
906491460 1:46271946-46271968 TCTAAGCTAGCATGTTTGGAAGG + Intronic
916290000 1:163155244-163155266 CATAAATAAGAATGTTTGGGAGG - Intronic
920598484 1:207297666-207297688 CTTAATCAAGCATGTTTGCATGG + Intergenic
923122388 1:231003936-231003958 CATAATCTCGCATTTCTTGGAGG - Intergenic
1065221114 10:23496846-23496868 CATAATTAAGCATATTTGGCAGG - Intergenic
1065224067 10:23524892-23524914 TATAATCTCGGCTGTTTGGGAGG - Intergenic
1072945448 10:99805780-99805802 AATAATCTAGCAAGTGTGAGGGG - Intronic
1074107574 10:110400026-110400048 AATAATCTTGGATGGTTGGGTGG - Intergenic
1074329237 10:112487422-112487444 CCTAATCTTGCATTTTTGAGAGG + Intronic
1074599392 10:114898372-114898394 CATACTCTTGCAAGTTTGGCTGG + Intronic
1080171711 11:29311548-29311570 CATAATCTACCATGTCTTTGTGG + Intergenic
1080413435 11:32047875-32047897 CATAATTCAGCAGGTCTGGGTGG - Intronic
1082758501 11:57102572-57102594 CTTACTCTAGCATGTATGGAAGG + Intergenic
1085824646 11:79831959-79831981 CATTATCTAGCCTGTGTGGGTGG - Intergenic
1109624229 13:64954366-64954388 CAGATGCTAGCATGGTTGGGTGG - Intergenic
1109829037 13:67761598-67761620 CATAAACTATATTGTTTGGGAGG + Intergenic
1109991145 13:70059424-70059446 CATAATCTCACCAGTTTGGGAGG - Intronic
1111080589 13:83301912-83301934 CATAATCTAGAATCAGTGGGAGG + Intergenic
1113228326 13:108182922-108182944 AATGATTTAACATGTTTGGGTGG - Intergenic
1116079884 14:40157936-40157958 CCTTATCTAGTTTGTTTGGGAGG - Intergenic
1118059901 14:62124538-62124560 TACAATCTAGTATCTTTGGGAGG + Intergenic
1125755473 15:42061394-42061416 TGTAATCTAGCAGGTTTGGGAGG + Intergenic
1127180677 15:56413840-56413862 CATCCTCTAACATGTTTGAGAGG + Intronic
1137866002 16:51897200-51897222 CATAATTTAGAATGTATGGGTGG - Intergenic
1139623615 16:68167154-68167176 AATGAGCTAACATGTTTGGGTGG + Intronic
1141258305 16:82424974-82424996 CAGAATCTAAAATCTTTGGGTGG + Intergenic
1148256339 17:46135785-46135807 TATAATCCAGCACTTTTGGGAGG - Intronic
1155862087 18:30914635-30914657 AATAATCAGGCATGTTTGTGTGG - Intergenic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1159561622 18:70001305-70001327 CATATCCTAGCATTTTTGGTGGG - Intergenic
1160475636 18:79183745-79183767 GATTATCTACCATTTTTGGGGGG + Intronic
1162391043 19:10390384-10390406 CAGAATCAAGAATGTTTGGGGGG + Intergenic
1163972772 19:20815582-20815604 CATAATCTAACTTTTTTGGGGGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
928613309 2:33011812-33011834 CATAAGCGATCAGGTTTGGGAGG - Intronic
932538537 2:72625607-72625629 CATATGCTAGCAAATTTGGGAGG - Intronic
932919376 2:75892267-75892289 TATAATATAGCATGTTTCAGTGG + Intergenic
936016154 2:108960465-108960487 TATAATCTGGAATGTTTGGAAGG + Intronic
937811515 2:126204794-126204816 CATGATCTAGTATTTTTAGGTGG + Intergenic
938759751 2:134413093-134413115 CTTCATCTAACATGATTGGGTGG + Intronic
939765823 2:146248441-146248463 CATAAGATAGCATGTATGAGAGG + Intergenic
941207662 2:162594202-162594224 TATAAACTAGCATGTCTGTGAGG - Intronic
943901103 2:193437749-193437771 CATACTATAGCATGTTGGAGAGG - Intergenic
945218800 2:207463631-207463653 CATCTTCTGGCATGATTGGGAGG + Intergenic
947655218 2:231820994-231821016 CTTCCTCTGGCATGTTTGGGAGG + Intergenic
1174189300 20:48728783-48728805 CACAATCTAGAGTGTTTGTGGGG - Intronic
1174246441 20:49185621-49185643 AATAATCTAGTTTGTGTGGGGGG + Intronic
1174632594 20:51970909-51970931 CGTGATCAAGCAAGTTTGGGAGG - Intergenic
1177860347 21:26445348-26445370 AAAAATCTAGCAAGTTTTGGTGG + Intergenic
1178116538 21:29423527-29423549 CATTATCTCTCAGGTTTGGGGGG - Intronic
949738440 3:7201223-7201245 AATATTCTAAAATGTTTGGGAGG - Intronic
951822588 3:26828739-26828761 CATAATCTTATATGTCTGGGAGG - Intergenic
951963828 3:28359807-28359829 CATAATCTACAATGTGTAGGGGG - Intronic
952304468 3:32133688-32133710 CATAAAATAGCATCTTTGGAGGG + Intronic
955779274 3:62466431-62466453 CAAATATTAGCATGTTTGGGAGG + Intronic
964097160 3:152945701-152945723 CATAATTTAGAATGTTAAGGGGG + Intergenic
964593034 3:158387966-158387988 CATAATCTATCATTTTTGGCAGG + Intronic
968850987 4:3078113-3078135 GCAAATCTAGCATGCTTGGGAGG + Intronic
972593897 4:40513560-40513582 TATAATCTAGCTTTTTTGGGTGG - Intronic
978016152 4:103749132-103749154 TATAATCTAGCTTGTTTCAGAGG - Intergenic
987017344 5:13834408-13834430 CATGAAGTAGCATGTGTGGGAGG - Intronic
987459064 5:18184818-18184840 AATAAGCTAGCATGATTGGAGGG + Intergenic
987561407 5:19526665-19526687 CATGATTTAGATTGTTTGGGTGG - Intronic
987932765 5:24423936-24423958 CATAATCTGTCATTCTTGGGTGG - Intergenic
988108203 5:26777412-26777434 CATAGTCTAGGATCTTTGGGTGG - Intergenic
988503428 5:31801832-31801854 CATAATGGAGAGTGTTTGGGAGG + Intronic
991574445 5:68088321-68088343 TTTTATTTAGCATGTTTGGGAGG - Intergenic
994957179 5:106546920-106546942 TATAATCTACCAGGTGTGGGTGG - Intergenic
996732143 5:126726748-126726770 CATAATCCTACCTGTTTGGGAGG - Intergenic
1006193934 6:32225990-32226012 CCTATTATAGCATGTTTAGGTGG + Intergenic
1008698517 6:54070414-54070436 CATATACTAGCATGTTTTTGTGG - Intronic
1009047422 6:58247838-58247860 CATAATCTCCCAAGTTTGAGAGG + Intergenic
1012149320 6:95726272-95726294 CACAATATAGCATTTTTGGGGGG - Intergenic
1012372457 6:98524184-98524206 CATTATCTAGCATTTGTTGGAGG - Intergenic
1013928026 6:115495808-115495830 CATAATAGAGAATGATTGGGTGG + Intergenic
1015886063 6:137919994-137920016 GATAGTCTAGCTGGTTTGGGAGG + Intergenic
1016432813 6:144006289-144006311 CATATTTTAACATATTTGGGGGG + Intronic
1021479227 7:21097425-21097447 ATTAATCTAGCAGGTGTGGGAGG + Intergenic
1022526676 7:31042500-31042522 CATAAGCCAGCATGTTTAGGGGG + Intergenic
1023284966 7:38609372-38609394 TATAATCAAGCATGGTGGGGAGG - Intronic
1024469052 7:49748271-49748293 CATGATCAAGTATGTTTGGCTGG + Intergenic
1026043087 7:66885224-66885246 CATAATGTAGAATGAGTGGGAGG - Intergenic
1026173753 7:67977463-67977485 GATAAGCAAGCATCTTTGGGAGG + Intergenic
1030538297 7:110796166-110796188 CATAGTTTAGCATGGCTGGGAGG - Intronic
1030815263 7:114028338-114028360 CATAATCTAGCATGTTTGGGAGG + Intronic
1032916870 7:136500777-136500799 CAGAATCTATCCTGATTGGGAGG + Intergenic
1033202518 7:139385575-139385597 CATATCCCAGCATGTTTGAGAGG - Intronic
1033566850 7:142587112-142587134 CATGATCTAGCATGTTCTAGAGG + Intergenic
1038174966 8:25173556-25173578 TATACTCTATCATGTTTAGGAGG + Intergenic
1040523732 8:48199796-48199818 CAGAATCTGGCAGGTTTGGGGGG - Intergenic
1045394275 8:101745019-101745041 CATCATCAAGCATTTCTGGGGGG + Intronic
1046009912 8:108533796-108533818 AATTATCTAGCAGATTTGGGAGG - Intergenic
1048521060 8:135155713-135155735 TATAATTTGGCATGTTTTGGGGG + Intergenic
1049221970 8:141432541-141432563 CACAGTCTAGCAGGGTTGGGGGG + Intergenic
1051671130 9:19511856-19511878 CATAATCTCGCGTGTGTGTGGGG + Exonic
1061477407 9:130877583-130877605 CCTCCTCTAGCATGTTTGTGGGG + Intronic
1186070122 X:5810087-5810109 AATACTCTAGCGTGCTTGGGAGG + Intergenic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1187999674 X:24968919-24968941 CATAATCTAGCAGGATGCGGTGG + Intronic
1192365679 X:70470977-70470999 CAGTTTTTAGCATGTTTGGGTGG + Intronic
1194970478 X:100337908-100337930 CATAATTTTACATGTTTGTGGGG - Intronic
1201635070 Y:16113515-16113537 GCTAAGCTATCATGTTTGGGAGG + Intergenic
1202193166 Y:22265933-22265955 CATAATGTAGAATCTATGGGAGG + Intergenic