ID: 1030820754

View in Genome Browser
Species Human (GRCh38)
Location 7:114087747-114087769
Sequence GTGTGGACCCTCACTTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030820742_1030820754 24 Left 1030820742 7:114087700-114087722 CCTCTGCCCACCCGCGAGGCCGC 0: 1
1: 0
2: 2
3: 29
4: 285
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820746_1030820754 13 Left 1030820746 7:114087711-114087733 CCGCGAGGCCGCAACGCGCCCTG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820748_1030820754 -5 Left 1030820748 7:114087729-114087751 CCCTGACACCCGACCTCAGTGTG 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820743_1030820754 18 Left 1030820743 7:114087706-114087728 CCCACCCGCGAGGCCGCAACGCG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820749_1030820754 -6 Left 1030820749 7:114087730-114087752 CCTGACACCCGACCTCAGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820744_1030820754 17 Left 1030820744 7:114087707-114087729 CCACCCGCGAGGCCGCAACGCGC 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820745_1030820754 14 Left 1030820745 7:114087710-114087732 CCCGCGAGGCCGCAACGCGCCCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121
1030820747_1030820754 5 Left 1030820747 7:114087719-114087741 CCGCAACGCGCCCTGACACCCGA 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030820754 Original CRISPR GTGTGGACCCTCACTTGCTG TGG Intronic
905497326 1:38403115-38403137 GTGGGGACCCTCAGTCCCTGGGG + Intergenic
910158380 1:84246286-84246308 GTGTGGTCCGCCACTTGCTAGGG - Intergenic
910492817 1:87791497-87791519 TTGTGGACCCTCAATTTCAGAGG - Intergenic
915530272 1:156499198-156499220 GGCTGGACCCTGAATTGCTGCGG + Intronic
916737108 1:167617767-167617789 CTGTTGACACTCACTTCCTGAGG + Intergenic
918197864 1:182239519-182239541 GTGTAGAGCATCACATGCTGAGG + Intergenic
920310254 1:205044278-205044300 CTCTGGACACTCACTGGCTGGGG - Intronic
922184319 1:223260562-223260584 CTGTGGGCCCTGGCTTGCTGTGG - Intronic
923251044 1:232180072-232180094 CTGTTTACCCTCCCTTGCTGGGG - Intergenic
1062855674 10:778383-778405 GTGGGGAGCCTCACTTCCTCGGG + Intergenic
1062855691 10:778457-778479 GTGGGGAGCCTCACTTCCTCGGG + Intergenic
1062874245 10:932039-932061 GTGTGGGCCCTGACTTCCGGAGG + Intergenic
1064768289 10:18697171-18697193 CTGTGGCTCCTCACTGGCTGTGG - Intergenic
1067932799 10:50580408-50580430 GGGGGGTCCCTAACTTGCTGTGG - Intronic
1071888490 10:89976999-89977021 GTGTGTACAATCACTGGCTGTGG + Intergenic
1075384839 10:122048204-122048226 GTGGGGACCCTCCCTTCCTGGGG + Intronic
1076163758 10:128266045-128266067 GTGAGGACCCTCACTCTGTGGGG + Intergenic
1076805464 10:132855939-132855961 GTGTGGATCCACACTTCCAGTGG + Intronic
1077329383 11:1977270-1977292 GCCTGGATCCTCACTGGCTGTGG + Intronic
1078929948 11:15905349-15905371 GTGTGAACCCACCCATGCTGGGG + Intergenic
1080106249 11:28514045-28514067 GTGTTGACCTTCACTTAATGTGG + Intergenic
1081811739 11:45918011-45918033 GTTTGGGCCCTCAGTTGCTAAGG - Intronic
1081848804 11:46260610-46260632 GCCTTGACCTTCACTTGCTGAGG - Intergenic
1086963794 11:93007351-93007373 GTGTGGAGGCTCAGTTGATGGGG - Intergenic
1202812363 11_KI270721v1_random:32449-32471 GCCTGGATCCTCACTGGCTGTGG + Intergenic
1093140814 12:15508609-15508631 ACGTGGACACTCACGTGCTGCGG - Exonic
1094099101 12:26742040-26742062 GTGTGGGCACTCCCTTGCAGAGG - Intronic
1102170924 12:110841948-110841970 GGGTGGACCCTAAGTTCCTGAGG - Intergenic
1103189602 12:118989976-118989998 GTGTGCACGCTCACTTGTGGTGG + Intronic
1104843562 12:131835690-131835712 GTGTGGACCCTTCCCTGGTGAGG + Intronic
1105800693 13:23900943-23900965 GTGTGGACCATCACTTGGGAAGG + Intronic
1105848340 13:24312147-24312169 GTGTGGACCATCACTTGGGAAGG - Intronic
1106884580 13:34170599-34170621 GTTTGGACTCTAACTTGATGTGG + Intergenic
1110622901 13:77618884-77618906 TTGTGGGCCCACACTAGCTGTGG - Intronic
1114534545 14:23414594-23414616 GTGTGGACTCTAGCTTTCTGAGG - Intronic
1115446890 14:33500705-33500727 TTGTGGGCTCTCACTTTCTGAGG + Intronic
1122781813 14:104146959-104146981 CTGTGGCCCCTCACATGCAGAGG + Intronic
1122873544 14:104652252-104652274 GGGTGGACACACACTTGGTGGGG - Intergenic
1126130065 15:45332138-45332160 GTATGATCCCTCACTTCCTGGGG + Intergenic
1126634589 15:50768248-50768270 GTGGGGAACCTGGCTTGCTGTGG - Intergenic
1132712199 16:1274026-1274048 GTGAGGACCTTCACCTGCTGCGG + Intergenic
1134824618 16:17274621-17274643 GTGTGGAGCCTCACATGGTCTGG + Intronic
1137933479 16:52610472-52610494 GTGTGGACCCTGAGGGGCTGTGG - Intergenic
1138262585 16:55636005-55636027 GTGTGGACCTTCACTTCCCTGGG - Intergenic
1139137002 16:64216571-64216593 GTGTGGACCCTCCCTCTCTGAGG - Intergenic
1142852088 17:2709232-2709254 TGCTGGAGCCTCACTTGCTGAGG - Intronic
1143103133 17:4514898-4514920 GTGTGGCCCCTGACTCACTGGGG + Intronic
1146686915 17:34847263-34847285 GTGTGGCCCCTTCCTTGCTGGGG - Intergenic
1150761123 17:67962509-67962531 GTGTAGACCCTCACAGGCTTTGG + Intronic
1151203602 17:72488208-72488230 GTGGGGACCCACAGTTGGTGAGG - Intergenic
1153681716 18:7507428-7507450 GTGTGGACCTTCACTGACAGAGG - Intergenic
1158264571 18:55647575-55647597 GTCTGGACTCTCACTTGTTTGGG + Intronic
1161063251 19:2225801-2225823 GTGAGGACCCTGACCTGCTCTGG + Intronic
1161316839 19:3621196-3621218 TGGGGGACCCTGACTTGCTGAGG - Intronic
1163315371 19:16537311-16537333 CGTTGGACCCTCACATGCTGGGG + Intronic
1164549181 19:29193997-29194019 GTGGGGACTCTCTCTTGCTTTGG - Intergenic
1164888089 19:31800451-31800473 TGGTGGACGCTCAGTTGCTGTGG - Intergenic
925860309 2:8168945-8168967 GTGAAATCCCTCACTTGCTGGGG - Intergenic
927591722 2:24362464-24362486 AGGAGGCCCCTCACTTGCTGGGG + Intergenic
927760585 2:25749915-25749937 CTGTGGACCCGCTCCTGCTGTGG + Exonic
931687350 2:64805840-64805862 GTGTGGGCCCTCCCCTGCTCTGG - Intergenic
937143827 2:119625457-119625479 CTGTGGACTCTGACTTGCAGTGG + Intronic
942844078 2:180402076-180402098 GTCTGGATAATCACTTGCTGTGG + Intergenic
948214281 2:236216973-236216995 GTGTGGGCCATCACGTGCAGCGG - Intronic
948616617 2:239203226-239203248 GGGTGGGCACCCACTTGCTGGGG - Intronic
1169854420 20:10087939-10087961 AAGTTGACCCTCACTTCCTGAGG - Intergenic
1171189876 20:23151336-23151358 GAGAGGGCCCTCCCTTGCTGTGG + Intergenic
1172600078 20:36177413-36177435 CTGTGAAACCTCACTGGCTGTGG + Intronic
1174429211 20:50455888-50455910 CTGTGGCCCCTCCCTTACTGGGG - Intergenic
1174609977 20:51790913-51790935 GGGTGGACCCACACTCCCTGGGG - Exonic
1175408768 20:58752449-58752471 GTGTGGACGTCCGCTTGCTGTGG - Intergenic
1175668398 20:60879962-60879984 GGCTGCACCCTCATTTGCTGGGG + Intergenic
1176377948 21:6096011-6096033 ATGGGGACCCTCACCTTCTGGGG + Intergenic
1178790570 21:35695899-35695921 GTGTGGACCCTCAGCTGAGGAGG + Intronic
1179745526 21:43442237-43442259 ATGGGGACCCTCACCTTCTGGGG - Intergenic
1180005054 21:45016817-45016839 ATGTGGACCCTCCCTGGCTGAGG - Intergenic
1180222236 21:46366292-46366314 GTGTGTGCCATCTCTTGCTGAGG + Intronic
1180541541 22:16453174-16453196 GTGGGGAACATCACATGCTGGGG + Intergenic
1180949860 22:19716090-19716112 GTGGGGACCCCCTCCTGCTGAGG + Intronic
1182683405 22:32100970-32100992 GGGTGCACCCTTTCTTGCTGTGG - Intronic
1183060483 22:35333602-35333624 GTCTGGACCCCACCTTGCTGGGG + Intronic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
1183946451 22:41328799-41328821 GTATGTATCGTCACTTGCTGGGG + Intronic
955053211 3:55432094-55432116 GTTTGGACCCTTACCTTCTGAGG - Intergenic
961122915 3:124388695-124388717 GTGGGGAATCTAACTTGCTGAGG + Intronic
969217645 4:5734998-5735020 CTGTGGACACTCGCTGGCTGTGG - Intronic
969450823 4:7272018-7272040 GTGTGCACACTCACATGCTTGGG + Intronic
970319910 4:14864833-14864855 GTGTAAGCACTCACTTGCTGTGG - Intergenic
973982197 4:56315921-56315943 GTGTGGGCCACCACTTTCTGCGG - Exonic
981000775 4:139826536-139826558 TTGTGGACAATCAATTGCTGAGG + Intronic
982209017 4:153020144-153020166 CTGTGAACTCTCAATTGCTGGGG + Intergenic
989726269 5:44590053-44590075 GTGTAGACAGTCACTGGCTGTGG + Intergenic
991462079 5:66869808-66869830 GTGTTGACTCTCACTTGCATGGG + Intronic
992357505 5:76001151-76001173 TTGGGGACCCTGGCTTGCTGGGG + Intergenic
993869844 5:93239758-93239780 GTGAGGACACTTACTTGCTTGGG - Intergenic
1004258080 6:14083269-14083291 GAGTGGAACCTCATTTGCTAAGG - Intergenic
1007288756 6:40768371-40768393 GTTTGGACACTCACGTGATGTGG - Intergenic
1015738510 6:136427381-136427403 TTGTAGACCCTCACTTAATGGGG + Intronic
1019367882 7:644630-644652 GGGTGGACGCTCAGCTGCTGAGG - Intronic
1019392324 7:795240-795262 GTGTGGACCCTCCCAGGCTCTGG - Intergenic
1019798707 7:3071983-3072005 CTGTGGACGGTCACTTGCAGTGG + Intergenic
1022017581 7:26365137-26365159 TTCTGGACACTCACTTTCTGAGG - Exonic
1022125577 7:27353134-27353156 GGGTGGACCCTGGTTTGCTGAGG - Intergenic
1023516990 7:41011041-41011063 GTTTGGACATTCACTTACTGAGG + Intergenic
1024499793 7:50093054-50093076 GCGCGGACCCTCACCTGATGAGG + Exonic
1029692186 7:102189888-102189910 CTGTGGCCCCTCACACGCTGGGG + Intronic
1030820754 7:114087747-114087769 GTGTGGACCCTCACTTGCTGTGG + Intronic
1033274667 7:139962446-139962468 GTGTGCACCTTCACTGTCTGGGG + Intronic
1036125263 8:6056534-6056556 GTGTGGCCCCTCAGTAGCTTGGG + Intergenic
1036621564 8:10427581-10427603 GAGTGTCCCCTCACTCGCTGTGG - Intronic
1038874672 8:31535001-31535023 GGGGGGACCCTCACCTGCTCTGG + Intergenic
1041182095 8:55259565-55259587 ATGGGGACCCTCGCTTGATGTGG + Intronic
1041948792 8:63476782-63476804 GTCTTCACCCTCACTTGCTTTGG - Intergenic
1042787960 8:72570778-72570800 GTGTTTGTCCTCACTTGCTGAGG + Intronic
1044514868 8:93126396-93126418 GACTAGACCCTCACTTGCTATGG + Intergenic
1045259032 8:100555974-100555996 GTTTGGACATTAACTTGCTGAGG + Intronic
1048715288 8:137261833-137261855 GTGTGGCCCACCATTTGCTGGGG + Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059584941 9:115595963-115595985 GTGCTGTCGCTCACTTGCTGGGG - Intergenic
1060221024 9:121764179-121764201 GTGTGGGCCCCCACTTGGGGTGG + Intronic
1061160742 9:128892514-128892536 GGGTACACCCTCACTTCCTGGGG - Intronic
1062067471 9:134536466-134536488 GTGTGGACCCTCCTCTGCTGAGG + Intergenic
1062525455 9:136976418-136976440 CTGTGGCCCATCCCTTGCTGGGG - Intergenic
1187102196 X:16205226-16205248 TTGTGGACCCTCAGTTTCTCTGG + Intergenic
1188309753 X:28601657-28601679 ATGTGCATCCTCAGTTGCTGTGG - Intronic
1195289032 X:103413998-103414020 GTGTGCACAGTCACTGGCTGGGG - Intergenic
1197738713 X:129872661-129872683 GGGTGGACCCACACTCCCTGGGG + Intergenic
1199720212 X:150538099-150538121 ATGTGGAGCCTCATTTGCAGCGG - Intergenic