ID: 1030823724

View in Genome Browser
Species Human (GRCh38)
Location 7:114128244-114128266
Sequence GAATTTTCTGCAACTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030823721_1030823724 7 Left 1030823721 7:114128214-114128236 CCTTGGTTTTAATGTGCAAACAA 0: 1
1: 0
2: 1
3: 19
4: 234
Right 1030823724 7:114128244-114128266 GAATTTTCTGCAACTCTTAATGG 0: 1
1: 0
2: 1
3: 20
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030823724 Original CRISPR GAATTTTCTGCAACTCTTAA TGG Intronic
901285170 1:8072594-8072616 GAATTTTCTTCAACTTATATAGG + Intergenic
904980955 1:34501111-34501133 TAATTTTCTGCCTCTTTTAAAGG - Intergenic
905086952 1:35388845-35388867 TAGTTTTCTGCAACTTTAAATGG - Intronic
906167318 1:43696439-43696461 GACTTTTCTGCAACCCCAAATGG - Intronic
908142091 1:61196455-61196477 GTTTTCTCTGCTACTCTTAAGGG + Intronic
908863396 1:68516766-68516788 GAATTTACTGTAACTATGAAAGG + Intergenic
910074477 1:83261168-83261190 AATTTTTCTGCAACTCTCTAGGG + Intergenic
910858170 1:91717159-91717181 AAACTTTCTACAACTCTTAAAGG - Intronic
910858176 1:91717226-91717248 AAACTTTCTACAACTCTTAAAGG - Intronic
911268587 1:95773731-95773753 GAAATTTCTGCAAATGTTAAAGG + Intergenic
912740598 1:112191659-112191681 GAATTTTAGACAACTCTGAAAGG + Intergenic
913448167 1:118972059-118972081 AAGTATTCTGCAACTCTCAAAGG - Intronic
914454157 1:147820075-147820097 GAATCGTCTGCATCTCTCAAGGG + Intergenic
915252217 1:154598664-154598686 GAATTTTCTGCTACGCTAAGGGG + Intronic
917159162 1:172038108-172038130 GAATTTTGAGCATCTCTGAAGGG + Intronic
919659262 1:200227629-200227651 GATTTTTCTGGAACTCTTATTGG + Intergenic
920580252 1:207099830-207099852 GAACTTTATGCAACAATTAAAGG + Exonic
920809193 1:209266158-209266180 GAGTTCTCTAAAACTCTTAAAGG + Intergenic
922661042 1:227430540-227430562 GAATATGCTGGAACTCTTCAGGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923398466 1:233590926-233590948 GTATTTTCTGTAACTTTGAATGG - Intergenic
924190964 1:241552422-241552444 CAATTTTATGCAGTTCTTAAAGG - Intronic
924258444 1:242205384-242205406 GTATTTTCTACAATTTTTAAAGG - Intronic
1064492065 10:15869192-15869214 GATTATTTTGCAACTCTCAATGG - Intergenic
1064845006 10:19642353-19642375 GTATTTTCTGTACCTCTGAATGG - Intronic
1066091803 10:32029781-32029803 GAGTTTTTTACAACTCTGAAAGG - Intronic
1066377224 10:34868322-34868344 TAATGTTCTGAATCTCTTAAAGG - Intergenic
1067724565 10:48760175-48760197 TAATTTCCTCCAACTCTAAAAGG - Intronic
1067737088 10:48865215-48865237 GAATTTTCTCAATCTCATAAAGG - Intronic
1069216222 10:65824746-65824768 GCATTTTCTTAAACACTTAAAGG + Intergenic
1069507031 10:69008695-69008717 GAATGATCTGCAACTCTACAGGG + Intronic
1070049140 10:72869862-72869884 GAATATTATGCAACTATTAAAGG + Intronic
1070351745 10:75599259-75599281 AAATGTTCTACACCTCTTAATGG - Intronic
1071104219 10:82075904-82075926 GAAATTTCTGAAAATCATAATGG + Intronic
1072210047 10:93238264-93238286 GAAATTTTTACATCTCTTAATGG + Intergenic
1073775072 10:106776157-106776179 GGCTTTTCTCAAACTCTTAAAGG - Intronic
1074208820 10:111309086-111309108 GAATATACTGCACCTCTTGATGG + Intergenic
1074871315 10:117578280-117578302 TAATGTTCTGCAAATCTCAAGGG + Intergenic
1075487397 10:122836197-122836219 GAATTTTCTGTCCCTCTTAATGG - Exonic
1075622227 10:123936389-123936411 GAAGTGTCTGCAGCTCTTATCGG + Intronic
1077387611 11:2278199-2278221 GAACTTTCTGCAGCTCTCTAGGG - Intergenic
1078771255 11:14354451-14354473 GAAATTTCTCCAACTCAAAACGG + Intronic
1080136052 11:28856535-28856557 GAATTTTCTGAAACATTTAGTGG - Intergenic
1081184318 11:40023318-40023340 GTATTTTCTGCCACACTAAATGG + Intergenic
1081422330 11:42883794-42883816 GAATTTTCTGAATCTAATAAAGG + Intergenic
1082140038 11:48598401-48598423 GAATTTTCTCCATCTCTTCTAGG + Intergenic
1083965470 11:66041353-66041375 CAATTCTCTGCTAGTCTTAAGGG + Intergenic
1086178767 11:83924286-83924308 AAATTTTCTGCCACTCTGCAAGG + Intronic
1086694881 11:89831650-89831672 GCATTTTCTCCAACGTTTAATGG - Intergenic
1086711267 11:90012846-90012868 GCATTTTCTCCAACGTTTAATGG + Intergenic
1088094597 11:106084137-106084159 CAATTTTCTGCAAATCTGATGGG - Intronic
1088659715 11:112033533-112033555 GAGATTTCTTCAGCTCTTAATGG + Intronic
1090722278 11:129487174-129487196 GAATTTTCTTGCACTCTTTATGG - Intergenic
1090809800 11:130227457-130227479 GCATTTTGTGAAACTCTCAAGGG - Exonic
1091128303 11:133121946-133121968 GAATATTTTGTAACTTTTAAGGG - Intronic
1092716456 12:11394029-11394051 AAATTTACTGCAACTATTCAGGG - Intronic
1093289442 12:17302616-17302638 GAATTTACTGGAACTCAAAAAGG + Intergenic
1093636551 12:21478003-21478025 TAATTTACTCTAACTCTTAAAGG - Intronic
1094105657 12:26808701-26808723 AAATTTTCTCAGACTCTTAAAGG + Intronic
1094602018 12:31917354-31917376 GAATTTTCTGCGGGTGTTAAAGG - Intergenic
1095152661 12:38813712-38813734 AAAATTTCTGTAGCTCTTAATGG - Intronic
1098001602 12:65949791-65949813 GAATTATTTGCAAATCATAAGGG + Intronic
1098090344 12:66894429-66894451 GAATTGTCTGGAACTCATAGAGG - Intergenic
1098158844 12:67628267-67628289 CAATTTTCTCCATCACTTAAAGG + Intergenic
1099058574 12:77877041-77877063 GAATTTTCTGCATAGCTTTAAGG - Intronic
1100242007 12:92719143-92719165 CAATTTTTTGAAACTCATAATGG + Intergenic
1100479178 12:94961348-94961370 GGATTTTCTTCAACTGTGAAGGG + Intronic
1100943236 12:99748033-99748055 CTATTTTCTACAGCTCTTAAAGG + Intronic
1101210815 12:102533750-102533772 GCATTTTCTGCAACTCCTCCAGG - Intergenic
1105469622 13:20681224-20681246 GCATCTTCTGCAACGCTTCACGG - Intronic
1105485729 13:20829594-20829616 GAACTGTCTGCAGCTCTTGAAGG - Intronic
1105530483 13:21214770-21214792 GAATCTCCAGCAACTCTGAATGG + Intergenic
1106915696 13:34511552-34511574 CTATTTTTTGCATCTCTTAAGGG + Intergenic
1107059649 13:36145033-36145055 GCATTTTCTGTATCTTTTAAAGG - Intergenic
1108295039 13:49007671-49007693 GAATTTTCTTGAAATCTTGAAGG + Intronic
1108606487 13:52044740-52044762 GAGGTCTCTGCAACTCTTATGGG - Intronic
1108669319 13:52667836-52667858 GAATTTTCAGCACCTTTGAAAGG + Intronic
1108831960 13:54490504-54490526 GCTTTTTCTGCATCTATTAAGGG - Intergenic
1108938618 13:55919798-55919820 GAATTTAATACAATTCTTAAGGG - Intergenic
1109715701 13:66219281-66219303 GGACTTTGTGCAACTCTAAAGGG + Intergenic
1114694756 14:24616267-24616289 GATTTTTCTACAGCTCTTATGGG + Intergenic
1116759910 14:48999112-48999134 GAAACTGCTGCATCTCTTAAGGG - Intergenic
1117536902 14:56711115-56711137 GAATTCTCTGCAACTCTCTTTGG - Intronic
1119202738 14:72770047-72770069 TAACTTTTTGCAACCCTTAATGG + Intronic
1119503132 14:75147867-75147889 GAATTTTCTGCAACTGAGCAGGG - Intronic
1123763355 15:23449891-23449913 GCATTTTCAGCAACTGTCAAAGG + Intergenic
1125194905 15:37034793-37034815 GATTTCTATGCAACTGTTAAAGG + Intronic
1125901207 15:43349777-43349799 GAGTTTTCAGCAATTCATAATGG + Intronic
1128847160 15:70909484-70909506 TAATTTTCTGCAACTGTTGTAGG + Intronic
1130069991 15:80638935-80638957 AAATATTCTGCAACTCTTCCTGG - Intergenic
1131503576 15:92995595-92995617 GAATACTCTGCAACTGTAAAAGG - Intronic
1133633508 16:7644350-7644372 GAATTTTCTCCACCTGATAATGG + Intronic
1134171522 16:11973428-11973450 GATTTTTCAGCAACTTTCAAAGG - Intronic
1134808970 16:17150917-17150939 CAATTTTCTGTCACTCATAAAGG - Intronic
1135526938 16:23220397-23220419 GACTTATCTGCAACTCTGAATGG + Intergenic
1135802621 16:25512018-25512040 GAGTTTTCTGTAAATCTTATTGG + Intergenic
1136171431 16:28492019-28492041 GAACATTCTGCTGCTCTTAAAGG - Exonic
1138197732 16:55064883-55064905 GAATTTTCTCCAGCTCTTGTCGG + Intergenic
1139406301 16:66720823-66720845 GAATTTTCTGCTAATCATATGGG - Intergenic
1140708180 16:77650600-77650622 GAAGCTTCTGCAGCTCTTCAGGG + Intergenic
1141917830 16:87112303-87112325 GATTTTTCAGCAAACCTTAAGGG + Intronic
1147675127 17:42199993-42200015 GAATTTTCATCAAATCTTGAGGG + Exonic
1150205076 17:63398085-63398107 GACTGTTCTGCAACTAGTAAAGG - Intronic
1150510082 17:65742516-65742538 GAATTTTCTGGTGCTATTAAGGG + Intronic
1153228235 18:2913611-2913633 GACTTTTCTGCCACTCTAACTGG + Exonic
1156083275 18:33366530-33366552 GAATTTTGTGCAATTCATGATGG + Intronic
1156238331 18:35226623-35226645 TAATTTTTTGCAAATCTTAAAGG + Intergenic
1156554767 18:38054702-38054724 GGATTTTCAGCAGTTCTTAAGGG + Intergenic
1156995594 18:43462861-43462883 GAATTTTCTGCTTTTCTTGATGG - Intergenic
1159169451 18:64746116-64746138 GAATTTTCTGCCACTCTGATGGG + Intergenic
1159275694 18:66218823-66218845 TAAATTTCTGCAGCTCTTATGGG - Intergenic
1163838714 19:19592645-19592667 GAATCTTCTGAACCTCATAAGGG + Intronic
1164306072 19:24004496-24004518 GAACTTTGTGAAACTCTTAGCGG - Intergenic
1166640866 19:44494307-44494329 GTGTTTTCTGGGACTCTTAATGG - Intronic
925697706 2:6598719-6598741 GGAATTTCTCCAAATCTTAAAGG - Intergenic
925867029 2:8237136-8237158 GATTTTTCTGCAAACCTTTAGGG + Intergenic
925935164 2:8750602-8750624 GACTCTTCTCTAACTCTTAAAGG + Intronic
926228707 2:10986580-10986602 GAATTTTCTAGAACTCTAAGGGG - Intergenic
927746889 2:25631211-25631233 GAATTTTATGTAATTTTTAATGG + Intronic
928571913 2:32617742-32617764 GAAGTTTCAGCAACTCTTCGCGG - Exonic
929193299 2:39160087-39160109 AAATTTTCTGAAATTTTTAAAGG + Intergenic
929925627 2:46205272-46205294 GATTTTTCTGGAGCTCTTAGTGG + Intergenic
930131757 2:47859116-47859138 ACATTTACTTCAACTCTTAATGG + Intronic
930518772 2:52437133-52437155 GAATGTACTGGAACTCTAAAAGG + Intergenic
931900182 2:66779807-66779829 GAATTTGCTAGAACTCTGAAGGG + Intergenic
932555737 2:72823961-72823983 CCATTTTCTTCAGCTCTTAAGGG - Intronic
935683615 2:105662317-105662339 GAATTTTCTTAAACTTATAAAGG - Intergenic
939132322 2:138251011-138251033 GAATTTACTGGCACACTTAATGG + Intergenic
940625384 2:156169121-156169143 GAATTTCCTGCCTCTCTTTAGGG - Intergenic
940968500 2:159867833-159867855 GAGATCTTTGCAACTCTTAATGG - Intronic
943170985 2:184399254-184399276 GAATTTTCTTAACCTATTAAAGG - Intergenic
943493968 2:188595349-188595371 GAATTTTCTTCAAGTGTTAAAGG + Exonic
943507340 2:188777974-188777996 GAATTTTCTGAAACTCTTGTTGG + Intronic
943619666 2:190134578-190134600 GAATTTTCTAAAAATATTAAAGG - Intronic
946721937 2:222617980-222618002 GATTTTTCAGTAAATCTTAATGG - Intronic
948313887 2:237012151-237012173 GCATTTTCCCAAACTCTTAATGG - Intergenic
1170107311 20:12765501-12765523 GAACATTATGCAACTTTTAAAGG - Intergenic
1170468674 20:16646643-16646665 GAACTTTCTGCAACTATCTAGGG - Intergenic
1171119319 20:22554851-22554873 GAATTTTCTGCTAGTCAAAATGG - Intergenic
1172112766 20:32557045-32557067 GACTTTTCTGCAGCTGTTACAGG + Intronic
1173790710 20:45826141-45826163 CAGTTTTCTGCAGCTCCTAATGG + Intronic
1173950706 20:46991131-46991153 AAATTTTCTCAAACTCTCAAAGG - Intronic
1175507921 20:59499343-59499365 GAAATTGTAGCAACTCTTAAAGG + Intergenic
1176366366 21:6035340-6035362 GCATTTTCTGCAGCTCAAAAAGG + Intergenic
1177644331 21:23883221-23883243 AAATGTTCTTCAACTTTTAATGG - Intergenic
1178220212 21:30648136-30648158 CAGTTTTCTGCAACTGTTAAGGG - Intergenic
1179757151 21:43503205-43503227 GCATTTTCTGCAGCTCAAAAAGG - Intergenic
1180101123 21:45586654-45586676 GGATTTCCTACAAATCTTAAGGG + Intergenic
1180650544 22:17372754-17372776 TAATTTTCTGCAACTTTAAAAGG + Intronic
1185170946 22:49293991-49294013 AAATTTTCTGGAGGTCTTAAGGG - Intergenic
950770909 3:15310193-15310215 GACCTTTCTGCAACTGTTAGAGG + Intronic
950908987 3:16567770-16567792 GAATGTTCAGCAAATATTAATGG - Intergenic
952160949 3:30692412-30692434 GATTTTTCTGCAACCCATGAAGG - Exonic
952938257 3:38418378-38418400 CAATTTTGTGAAACTCCTAAAGG + Intronic
953256008 3:41291103-41291125 GAAGCTTCTGCAACTTTTCAAGG - Intronic
956089820 3:65654087-65654109 GAATTTTTTTAAACTCTAAATGG + Intronic
956745514 3:72307879-72307901 GAATTTTCTGGACCTCATCAAGG - Intergenic
957853190 3:85838220-85838242 GAATCTTCTGCATCTTTAAAAGG + Intronic
959495906 3:107051606-107051628 GAATTTTCAGAAATTCTTACTGG + Intergenic
959649674 3:108739494-108739516 GAACTTGATGCAACACTTAATGG - Intergenic
959657072 3:108819955-108819977 CATTTTTCTGAAACTCTGAATGG + Intergenic
960120136 3:113940791-113940813 GAATCTTATGCAGCTGTTAAGGG - Intronic
960182360 3:114595603-114595625 GAATACCCTGGAACTCTTAATGG - Intronic
963842922 3:150126171-150126193 GAAAATTCTGCAATTCTGAAAGG - Intergenic
964428536 3:156579309-156579331 GAAGTTTCGGCAATTCTAAATGG - Intergenic
964930103 3:162008960-162008982 GAATTTAATGTAATTCTTAAGGG + Intergenic
965239460 3:166176523-166176545 GACTTTTCTGCAACTCATCACGG - Intergenic
965254653 3:166390238-166390260 GACTTTTCTGCAACTTTTAAAGG + Intergenic
965732935 3:171791938-171791960 GAATGTTCCGGAACTCTGAAAGG - Intronic
965777910 3:172252878-172252900 GACTTTTACACAACTCTTAAGGG + Intronic
970197449 4:13565963-13565985 GGCTATTCTGAAACTCTTAAGGG + Intergenic
971238959 4:24870004-24870026 GCATTTTCTGCTTCTCTTGAGGG + Intronic
972432688 4:38998802-38998824 GACTTTTCTGCAACCAGTAAGGG - Exonic
974023000 4:56708134-56708156 AAATTTACTGCAGCTCTTCAGGG - Intergenic
975115087 4:70671327-70671349 GCATTTTCTGCAACTCCACAAGG - Intronic
975332828 4:73138319-73138341 AAAATTTCTGCTAGTCTTAAGGG - Intronic
976436838 4:85028049-85028071 TAATTTTCTGTGACTCTTACTGG + Intergenic
977253370 4:94713265-94713287 TATTTTGCTTCAACTCTTAAAGG + Intergenic
977253435 4:94713916-94713938 TATTTTGCTTCAACTCTTAAAGG + Intergenic
979156745 4:117401995-117402017 GAATTTTCTGAAACTAATAAAGG + Intergenic
979964514 4:127061826-127061848 AAATAGTCTGCAAGTCTTAAGGG - Intergenic
980185110 4:129451273-129451295 AAATTTTCTCCCACTCTCAAGGG - Intergenic
986124329 5:4871158-4871180 GAATTTTCTGAGACTAATAAAGG + Intergenic
988361611 5:30242999-30243021 TATTTTTATGCCACTCTTAAAGG - Intergenic
990054579 5:51556237-51556259 GAGGTTTCTGCCACTATTAATGG + Intergenic
991334948 5:65536732-65536754 TAATATTCTGCAACTTATAATGG + Intronic
992894961 5:81237882-81237904 AAATATTCTGCAGCTATTAAAGG - Intronic
995231407 5:109768644-109768666 GATTTTTCTGAAACACTTAAGGG - Intronic
997052608 5:130400141-130400163 GAATTCCATGCAACTTTTAAAGG + Intergenic
997468030 5:134101161-134101183 GGATTTTCTGCCACCCTCAAGGG + Intergenic
998226209 5:140328444-140328466 AAAATTTTTGCAACTCTTTAAGG + Intergenic
998640921 5:144010342-144010364 GAAATTTCTGCCCCTTTTAAAGG + Intergenic
998775874 5:145601481-145601503 GAAGTTTCTACATCTGTTAATGG + Intronic
999816860 5:155185546-155185568 GAGTGTTCTCCAACTCTTCAGGG + Intergenic
999925631 5:156373089-156373111 AAATTATGAGCAACTCTTAATGG - Intronic
1002918149 6:1545608-1545630 GAATTTTGTGCAACTCATGTTGG - Intergenic
1003815177 6:9831845-9831867 GAATTTTTTAAAATTCTTAAAGG - Intronic
1004291075 6:14368111-14368133 GAATTATCTGCAACTTGGAAAGG + Intergenic
1004367061 6:15021609-15021631 GAAATTTATGTCACTCTTAAAGG - Intergenic
1004995740 6:21190715-21190737 TAATTGTCAGCAGCTCTTAAAGG + Intronic
1006622368 6:35374712-35374734 GAATTTTCTGTAACTACTTACGG + Intronic
1008780605 6:55099305-55099327 GAATTTTAAGCATCTCTTCATGG + Intergenic
1008891345 6:56495774-56495796 GAATTTTCTAGAAATCTTTATGG - Intronic
1009509792 6:64535800-64535822 GATTTTTCTGTAGCTTTTAAGGG + Intronic
1009638354 6:66296680-66296702 GAAGTTTTTACAACTCTTACTGG + Intergenic
1009689334 6:67007964-67007986 GAAATTTATGCAACTTTGAAAGG + Intergenic
1010960815 6:82143699-82143721 GACTTTTCTGCATCTCTTCCTGG + Intergenic
1011160874 6:84389011-84389033 GAAGTTTCTGCACCTATTAAAGG + Intergenic
1011205001 6:84882822-84882844 GACTTTTCTGTAGCTCTAAAGGG - Intergenic
1012630838 6:101465011-101465033 GCATTTTTTGGAACTATTAAAGG - Intronic
1013483776 6:110575791-110575813 GATTTTTCAGCAAATCTTCAGGG - Intergenic
1014246427 6:119074761-119074783 CAAGTTTCTGCAAATGTTAATGG - Intronic
1014880189 6:126714369-126714391 CAATTTTGAGCAACTCTGAAAGG + Intergenic
1015254661 6:131164492-131164514 GACTTCTTTGCAACTCTTCATGG + Intronic
1017974344 6:159342237-159342259 GAATTTTACTCAACTTTTAAAGG + Intergenic
1018297282 6:162362585-162362607 GAATTTTCTGCTATCCTAAAAGG - Intronic
1021368910 7:19816924-19816946 GAATATTTTGCCACTCTAAATGG + Intergenic
1022105809 7:27196859-27196881 GTATTTTCTGCAGATTTTAATGG + Exonic
1024361581 7:48474248-48474270 GAAATTTCTGCACCTCTTTGGGG - Intronic
1024915789 7:54498225-54498247 GAATTTTCTTTAACATTTAAGGG - Intergenic
1025269662 7:57497368-57497390 GAATTATCTTCAAGTATTAATGG - Intergenic
1027292176 7:76726033-76726055 AATTTTTCTGCAACTCTCTAGGG + Intergenic
1027318708 7:76999332-76999354 GAATTCTCTGCAGCACCTAAAGG + Intergenic
1028267104 7:88739300-88739322 GTATTCTCTGCCACTCTTAGAGG + Intergenic
1028752903 7:94401992-94402014 GAATTTTAAGCAACACTTAGAGG + Intronic
1030577018 7:111300833-111300855 GAATGTTCTGCAACTGTCAGTGG - Intronic
1030823724 7:114128244-114128266 GAATTTTCTGCAACTCTTAATGG + Intronic
1030825380 7:114150124-114150146 GATTTTACTTCAATTCTTAAAGG + Intronic
1036776610 8:11617337-11617359 GAATCTTCTGCAGCTCCTGACGG - Intergenic
1039771129 8:40688084-40688106 GAAGTTTTTGCAACTCTTTTTGG - Intronic
1041029674 8:53724169-53724191 GACTTTTCTCAAACTCTGAAAGG + Intronic
1046801927 8:118438090-118438112 GGCTTTTCTTAAACTCTTAAGGG + Intronic
1048688323 8:136929430-136929452 GAATTTACTCCAACTCTGATTGG + Intergenic
1048893932 8:138971729-138971751 GAATTATCTGAAGTTCTTAAAGG + Intergenic
1050784737 9:9387127-9387149 GAATTTTCTGCAACAGTAAATGG + Intronic
1050906129 9:11008937-11008959 GAATTTTATCAAACACTTAAAGG - Intergenic
1053372612 9:37575774-37575796 GTATTTTATGCAAATCTCAAGGG - Intronic
1055092496 9:72377338-72377360 GAAAATTCTGCAACTGTCAATGG - Intergenic
1055557109 9:77485913-77485935 AGATTTTGTGCAATTCTTAAGGG + Intronic
1057366721 9:94429115-94429137 AAATTTTCTGCCTCTTTTAATGG - Intronic
1057656613 9:96958949-96958971 AAATTTTCTGCCTCTCTTAATGG + Intronic
1059114345 9:111587400-111587422 GTATTTTCTGTCAATCTTAATGG + Intronic
1059373698 9:113864601-113864623 GCATTTTCTGCACCTGTCAAAGG - Intergenic
1059784888 9:117570908-117570930 GAGTATTCTGCAACTCCTACAGG - Intergenic
1060370092 9:123060614-123060636 GAAATTACTGGAACTCTCAATGG - Intronic
1061738014 9:132676264-132676286 GAATTTTCTGTTAGGCTTAATGG + Intronic
1062073119 9:134569762-134569784 GGATTTCCTACAACTCATAAAGG + Intergenic
1185748287 X:2589520-2589542 GAATGTGCTACAACTCTTCAGGG + Intergenic
1188155911 X:26742931-26742953 GAATTTTCTACAATTCTTCAGGG + Intergenic
1190162910 X:48046812-48046834 GAATCTTATACAACTCTTATAGG + Intronic
1192694662 X:73401272-73401294 GAATTTTCTGCCCCACTCAAGGG + Intergenic
1193109363 X:77712134-77712156 GATTTTTATCCAAGTCTTAAAGG + Intronic
1193656567 X:84205563-84205585 CAATTTTCTACAACTTTCAAAGG + Intergenic
1194811046 X:98387605-98387627 GTATATTCTGCTACTCTTCAAGG + Intergenic
1194846265 X:98813034-98813056 TATTTTTCTGCCATTCTTAATGG + Intergenic
1196150918 X:112372816-112372838 AAATTTTATCCAATTCTTAAAGG - Intergenic
1198094993 X:133371135-133371157 GACTTTTCTTCATTTCTTAATGG - Intronic
1198719724 X:139603366-139603388 GAATTTTCTCCCAAACTTAATGG - Intronic