ID: 1030827481

View in Genome Browser
Species Human (GRCh38)
Location 7:114177338-114177360
Sequence TTTCACACATTGATGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030827481_1030827483 11 Left 1030827481 7:114177338-114177360 CCTTCTACCATCAATGTGTGAAA 0: 1
1: 0
2: 1
3: 10
4: 191
Right 1030827483 7:114177372-114177394 TCCACATTTTGTCAACACTTAGG 0: 1
1: 0
2: 2
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030827481 Original CRISPR TTTCACACATTGATGGTAGA AGG (reversed) Intronic
902315486 1:15615655-15615677 TTTCAAACATTCACTGTAGAAGG + Intergenic
907638405 1:56159639-56159661 TTTAACAGATGGAAGGTAGAAGG + Intergenic
908893206 1:68869232-68869254 TTTCACACATTGAAGGTTTGTGG - Intergenic
911296591 1:96124924-96124946 TTTCACACATTGAAGGTTTTTGG + Intergenic
917463107 1:175249530-175249552 TTTCCCAGATGGATGGTGGAGGG - Intergenic
917658698 1:177155627-177155649 TTAAATACATGGATGGTAGATGG + Intronic
920565256 1:206967904-206967926 TTTCAGAGCATGATGGTAGAGGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922400761 1:225252127-225252149 TTTTACACATTGAAGATTGAGGG + Intronic
923532814 1:234825034-234825056 TTTTACAGATCGCTGGTAGAGGG - Intergenic
924841447 1:247713886-247713908 TTTACCTCATTGATGGCAGAAGG + Intergenic
1063807008 10:9656818-9656840 ATTCACACATTAATGGGAAAGGG - Intergenic
1064299751 10:14112880-14112902 TTACACACATTGAGGGAAGGGGG - Intronic
1065422889 10:25566528-25566550 TTTCTCTAATTGAAGGTAGACGG - Intronic
1065505185 10:26423198-26423220 TTTCACACAGTGGTGGCAAATGG - Intergenic
1069105563 10:64379697-64379719 TTTTGCACATTGCTGGAAGAGGG + Intergenic
1069577460 10:69541065-69541087 TTTCCCAGAATGATGGCAGATGG + Intergenic
1069874293 10:71552206-71552228 TTTCACACAGAGGTGGAAGAGGG + Intronic
1072378699 10:94843093-94843115 TCTCACCCAGTGATGGTAGAGGG - Intronic
1073681427 10:105708405-105708427 TTTTACAAATTGATGGTGCATGG + Intergenic
1076327601 10:129638851-129638873 TTTCAAACTTTGAGGGTAAATGG + Intronic
1079807647 11:24954525-24954547 TTTCTCACAATGATTGTATAAGG - Intronic
1080045910 11:27807927-27807949 GCTCACACATTTATGGCAGAAGG - Intergenic
1080563845 11:33490040-33490062 TTATACAGATTGATGGTAAATGG + Intergenic
1081350124 11:42041866-42041888 TTTCTCACAGTGATGGTACATGG + Intergenic
1081500091 11:43658376-43658398 TTTCACAAGTTGAGGGAAGAAGG - Intronic
1081766426 11:45614310-45614332 CTTCACACATTGAGAGTAGTGGG - Intergenic
1082879443 11:58023920-58023942 TGCCACACAGAGATGGTAGAGGG + Exonic
1089724393 11:120462532-120462554 TTTTACAAATTGAAGGTTGATGG - Intronic
1091061029 11:132462379-132462401 TTTCACAGGTTGTTGGTACAGGG - Intronic
1091353674 11:134917311-134917333 TTTCAAACATTTAAGGAAGAAGG - Intergenic
1091717080 12:2785596-2785618 GTTCACACATTTATGGCAGCAGG + Intergenic
1094622325 12:32091763-32091785 TTTCTCTCATTGCTGGTGGAGGG - Intergenic
1101615754 12:106335185-106335207 TTTCACACATTTTTGGTAAAAGG - Intronic
1102905210 12:116669389-116669411 CTGCTCACACTGATGGTAGATGG - Intergenic
1103396255 12:120609495-120609517 TTTCACAAAGTATTGGTAGAGGG - Intergenic
1104674469 12:130703363-130703385 TTTCAAACACTGATGTTAGATGG - Intronic
1106071631 13:26417379-26417401 TTTCACACATTGAAGGTTTGTGG + Intergenic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1108457096 13:50627240-50627262 TCTCACGCATTGCTGGTAGGAGG + Intronic
1111740874 13:92204774-92204796 TGTCACACATTGTTGCCAGAGGG - Intronic
1115574808 14:34700867-34700889 TTTCAGATCTTAATGGTAGATGG + Intergenic
1116666430 14:47781547-47781569 TGTCACACATTGATGTCAGGAGG - Intergenic
1117324569 14:54657235-54657257 TGTCACAGATAGGTGGTAGATGG - Intronic
1118393742 14:65318067-65318089 TCACACACATTGATGATGGAGGG - Intergenic
1120126026 14:80744612-80744634 TTTATCACACTGAGGGTAGAAGG - Intronic
1120427807 14:84372669-84372691 TTTCACAAATTGAAGGTTTATGG + Intergenic
1125359270 15:38848536-38848558 TGTTACCCATTCATGGTAGATGG - Intergenic
1134357879 16:13501181-13501203 TGTCACAAATTGAGGGTAGGGGG + Intergenic
1134605154 16:15564814-15564836 GTTCACACATTTATGGCAGCAGG - Intronic
1135530128 16:23245910-23245932 TTAAACACATTAATGGTAAAGGG + Intergenic
1143330886 17:6134595-6134617 TTTCATACATTGCTGGTGGCGGG - Intergenic
1144115589 17:12086741-12086763 TTTAACCAAGTGATGGTAGAAGG - Intronic
1148077071 17:44943598-44943620 TTTCACACTTTGTTGGTTTAAGG + Intronic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1152402141 17:80073291-80073313 TTTTACAAATTGAAGGTTGACGG + Intronic
1153752069 18:8242686-8242708 TTTCATACTTTGAAGGCAGAAGG - Intronic
1155116650 18:22775285-22775307 TCTTACTCATTGATGTTAGAAGG - Intergenic
1155846160 18:30709333-30709355 TTTCACACCTCATTGGTAGATGG + Intergenic
1157663589 18:49466857-49466879 TTTCACACAGTTATGGAAGCTGG - Intergenic
1158794460 18:60826536-60826558 TTACTCACATTGAAGATAGAGGG - Intergenic
1159140711 18:64390557-64390579 TTTCTCACATTGATAGCGGAGGG - Intergenic
1159495726 18:69201126-69201148 TTTCTCACATTCATTGTACATGG - Intergenic
1159751800 18:72311849-72311871 ATTCACACAGTGAGGGTAAAGGG - Intergenic
1159858362 18:73616100-73616122 TTTTAAACATTGATGATAGGTGG - Intergenic
1163328014 19:16617789-16617811 TTTCTCACCTTGATGGTTGGTGG - Intronic
1163882259 19:19935409-19935431 TTTCATAAACTGATGTTAGAAGG - Exonic
1163917302 19:20252401-20252423 TTTCACAAACTGATTTTAGAAGG + Intergenic
1164240121 19:23379649-23379671 TTTCACATCTTCATGGCAGAAGG + Intronic
1166602367 19:44108434-44108456 TTTCACCCATTCTTGGAAGAGGG + Exonic
1168481487 19:56723968-56723990 TTTCACAGATTGACCCTAGAAGG + Intergenic
925638312 2:5964058-5964080 TGTCTCACAATCATGGTAGAAGG + Intergenic
925761093 2:7185316-7185338 TTTCTCACATAGATGTTAAAAGG - Intergenic
930331836 2:49995114-49995136 TTTCTCACAGTGATTGAAGAGGG + Intronic
931075098 2:58702121-58702143 GTTCCCACCTTGATGATAGAAGG - Intergenic
931287639 2:60846124-60846146 TTTGAGAAAATGATGGTAGATGG - Intergenic
934111604 2:88748487-88748509 CTGCACACACTGTTGGTAGAAGG - Intronic
939210185 2:139164521-139164543 TTTCTCACAGTGCTGGAAGATGG - Intergenic
944860178 2:203808449-203808471 TTTCACACAGTTATTGGAGATGG + Intergenic
945399511 2:209363941-209363963 TTACATACCTTGACGGTAGATGG + Intergenic
946581568 2:221133719-221133741 TTTCCCACATTGATGGCAGTAGG + Intergenic
1169930404 20:10826709-10826731 TTTCCTACATTGCTGGTAAATGG + Intergenic
1173316761 20:41951463-41951485 TTTCACACATTGATAATAACTGG + Intergenic
1175559509 20:59908826-59908848 TTTCATAAATTGATGGTGAAGGG - Intronic
1177281033 21:18983626-18983648 TTTCACACATTTTAGGGAGACGG + Intergenic
1182207035 22:28638831-28638853 ATTCATACATTATTGGTAGAAGG + Intronic
1183910116 22:41072690-41072712 TCTCACACACTGAGAGTAGAGGG + Intergenic
949610465 3:5698679-5698701 TTTCACACCTTGATGGTTTTGGG + Intergenic
951307235 3:21079991-21080013 TTTCACAAATTGAAGGTTTATGG - Intergenic
955370881 3:58350688-58350710 CTTCAGACATTGTTGGGAGATGG + Intronic
955468808 3:59264581-59264603 TTTCTCACAATCATGGCAGAAGG - Intergenic
957177088 3:76825157-76825179 TGTTACACTTTGTTGGTAGAGGG - Intronic
959133856 3:102392270-102392292 ATTAACACAGTGGTGGTAGAAGG - Intronic
960542142 3:118872618-118872640 TTTCACACATAGTAGATAGAAGG + Intergenic
960549355 3:118956865-118956887 TTTCACACATTGAAGGTTTAAGG - Intronic
961352656 3:126313916-126313938 TTACACAAACAGATGGTAGACGG - Intergenic
963184674 3:142400975-142400997 TTTTACACCTGGATGGAAGATGG - Intronic
964091858 3:152886703-152886725 TTTCAAACATGGATGATAGTTGG - Intergenic
966799237 3:183747299-183747321 TTTCAGAGATTGATGGTCCATGG + Intronic
967167400 3:186794250-186794272 TTTCAAGTATTAATGGTAGAAGG + Intronic
969802384 4:9578831-9578853 TGTCTCACATGGATGGCAGAAGG - Intergenic
969865247 4:10071867-10071889 TTTCACACATTGAATGGAGAAGG + Intergenic
970230749 4:13908299-13908321 TTTCAGGCCTTTATGGTAGAAGG + Intergenic
970332017 4:14996233-14996255 TTTCACAAATTGAAGGTTGGTGG + Intergenic
970633177 4:17977354-17977376 TTTCATACATGGATGGCAGATGG - Intronic
970671872 4:18405965-18405987 TCACAGACATTGAAGGTAGAGGG + Intergenic
973190889 4:47384558-47384580 TTTCCCACATTGAGGATATAAGG + Intronic
975435705 4:74348772-74348794 TTCCACACATGGATGGAAGTGGG + Intergenic
976498968 4:85764327-85764349 TTTAACGCATTGATGATAGCAGG - Intronic
978223631 4:106307310-106307332 TTTCACACAGTAATGTTACAAGG + Intronic
979121033 4:116901590-116901612 TTTCACAAATTCATGGAACATGG - Intergenic
980218769 4:129886485-129886507 TCTCACAAGTTGATGTTAGATGG - Intergenic
981628652 4:146791229-146791251 TTTTACACATTGAAGGTGTATGG + Intronic
984011944 4:174381954-174381976 CTTCTCACATGTATGGTAGAAGG + Intergenic
984828907 4:183953301-183953323 TTTCACACAGGGGTGGTATATGG + Intronic
985355163 4:189110839-189110861 TTTCTCCTATTGATGGCAGACGG + Intergenic
986883810 5:12208974-12208996 TTTCATACATTGTTGGCAAAAGG - Intergenic
991468193 5:66937039-66937061 TTTCACTCATTGGAGGTGGAAGG + Intronic
991515352 5:67428780-67428802 TTTCATAAATTTTTGGTAGATGG + Intergenic
992166843 5:74060784-74060806 TTTCACACATTTCTTGTTGAGGG - Intergenic
993561108 5:89410534-89410556 TTTCACACAGTGAGGTTTGAAGG + Intergenic
993648726 5:90492270-90492292 TTTCAAAGATTGACTGTAGAAGG - Intronic
993976274 5:94486322-94486344 TTCATCACATGGATGGTAGAAGG + Intronic
994680549 5:102881456-102881478 TTTCATACATTGCTGGTGGGAGG + Intronic
995386381 5:111594272-111594294 TCTCACACCTTTATGGTAGGAGG - Intergenic
995422600 5:111983843-111983865 TTTCAAGCTTTGATGGTAAAAGG + Intronic
995747132 5:115415829-115415851 TTTCACACCTTGCTGCTAAAGGG - Intergenic
995928450 5:117405611-117405633 TTCCACACATTGTGGGTATAAGG + Intergenic
997231290 5:132245227-132245249 TTTCACACATTGTTACTTGAGGG - Intronic
999813487 5:155151745-155151767 TCTAACACATTTCTGGTAGAAGG - Intergenic
1005142938 6:22654829-22654851 TTCCACACATTGATATTTGATGG + Intergenic
1006066149 6:31463872-31463894 TGTCACACAATGAGGGTAGGAGG - Intergenic
1007150005 6:39680547-39680569 TCTCACAGATAGATAGTAGAGGG + Intronic
1008123593 6:47645067-47645089 TTTCACACATAGAGTGTAAAGGG - Intergenic
1008531068 6:52459592-52459614 TTTCACACACTGCTAGTGGAAGG + Intronic
1009458597 6:63886716-63886738 TATCACACATTTTTGGGAGATGG + Intronic
1010599954 6:77812601-77812623 TTTGACTCCTTGATGGTGGAGGG + Intronic
1011012373 6:82716358-82716380 TTTCACGAATTGAGAGTAGAAGG + Intergenic
1012960872 6:105620350-105620372 TTTTAGACATTGATGGTAAGAGG - Intergenic
1014376044 6:120675971-120675993 TATCACACATTGATGTGAAAGGG - Intergenic
1015761767 6:136669653-136669675 ATTCACATATTTCTGGTAGATGG - Intronic
1016600334 6:145851504-145851526 TTTCTCACAGTGATGGTATCAGG - Intergenic
1016661168 6:146582651-146582673 TTTCTCACATTTATGGAAGGTGG + Intergenic
1017407244 6:154133602-154133624 TTTCACACATTATTGGAAGGAGG - Intronic
1018847419 6:167565270-167565292 TGTCTTACATGGATGGTAGAAGG + Intergenic
1019348877 7:543831-543853 TTTCACACATTCCTGGCAGTTGG - Intergenic
1019781792 7:2944795-2944817 TTTCACAAAGTAAAGGTAGATGG + Intronic
1020464702 7:8464244-8464266 TCTCATACATTGTTGGTAAAAGG - Intronic
1021445994 7:20734153-20734175 TGTGACACATTCATGGTAGTTGG - Intronic
1023304511 7:38810577-38810599 TTTAACCCATTGTTTGTAGAAGG + Intronic
1023671202 7:42578595-42578617 TTCCACCAAGTGATGGTAGATGG + Intergenic
1024336723 7:48215554-48215576 TTTCACAAATTGAAGGTTCATGG - Intronic
1027854249 7:83488558-83488580 CTTCACACATTACTGATAGATGG - Intronic
1028080439 7:86568326-86568348 TTTGACAAATTGATGGAAGTAGG + Intergenic
1030143720 7:106331705-106331727 TGTCAAACATTGAGGCTAGATGG + Intergenic
1030183831 7:106739635-106739657 TGTCACACATTGATGCCAGGAGG - Intergenic
1030827481 7:114177338-114177360 TTTCACACATTGATGGTAGAAGG - Intronic
1032163482 7:129527887-129527909 TTGCACCCATTGAGGGTAGATGG + Intergenic
1033807991 7:144976432-144976454 TATCACACATTGATGCTACCAGG + Intergenic
1035794189 8:2338039-2338061 TTTGACAAATTGATGGAAGTAGG + Intergenic
1035798616 8:2383669-2383691 TTTGACAAATTGATGGAAGTAGG - Intergenic
1036364907 8:8111680-8111702 TGTCTCACATGGATGGTAGCAGG - Intergenic
1037145946 8:15573055-15573077 TTTTACAAATTGAAGGTTGATGG - Intronic
1039369996 8:36974508-36974530 TTTGACTCATTCATGGTAGCAGG - Intergenic
1041782033 8:61587315-61587337 TGACACAGATTGATGGTAGTAGG + Intronic
1042248522 8:66732296-66732318 TTTCACAAACTCATGGTTGATGG - Intronic
1042283791 8:67084273-67084295 TTTAACTCCTTGATGATAGAGGG - Intronic
1044090171 8:87990378-87990400 TTTGTCACATTGATAGTTGAAGG + Intergenic
1044098958 8:88105617-88105639 CTTCTCTCATTCATGGTAGAGGG + Intronic
1044286223 8:90414413-90414435 TTTCACAAAGTGTTGGTAAAGGG + Intergenic
1044547206 8:93472960-93472982 TGTCACACATTGATGCTGGGAGG + Intergenic
1046216963 8:111161349-111161371 TTTCTCACAGTCATGGTAAAAGG - Intergenic
1046240903 8:111490671-111490693 TTTAAGAAATTGATGATAGAGGG - Intergenic
1050497252 9:6256764-6256786 TTTCACACATTTATGTTACCTGG - Exonic
1050612982 9:7372367-7372389 TTTCACACATTCATATAAGATGG - Intergenic
1051122461 9:13766135-13766157 TTCCCATCATTGATGGTAGATGG - Intergenic
1052202904 9:25804104-25804126 TTTCATAAATTTGTGGTAGAGGG + Intergenic
1053179556 9:35957129-35957151 CTTCACTCAGTGATGGTGGAAGG - Exonic
1053386223 9:37692285-37692307 TTGCACACATAGTTGGGAGAGGG + Intronic
1053601495 9:39614823-39614845 TTTCAGATATTGGTGTTAGAAGG + Intergenic
1053859146 9:42368604-42368626 TTTCAGATATTGGTGTTAGAAGG + Intergenic
1054252038 9:62727615-62727637 TTTCAGATATTGGTGTTAGAAGG - Intergenic
1054566152 9:66762116-66762138 TTTCAGATATTGGTGTTAGAAGG - Intergenic
1055675436 9:78654677-78654699 TTTAATACTTTGATGGTAAAAGG + Intergenic
1056646290 9:88414735-88414757 TTGCACGCATTCATGATAGAAGG + Intronic
1058381759 9:104384461-104384483 TTTGACACATTGGTTGGAGAGGG - Intergenic
1060061730 9:120466777-120466799 TTTCCCACTTTGAAGGTAGGAGG + Intronic
1185959101 X:4527694-4527716 TATCACACATTGATCATATATGG - Intergenic
1186389626 X:9145853-9145875 CTTCTCAAATTGATGGTAAATGG + Intronic
1186976381 X:14910688-14910710 TCTCACACATTATTGGTAAATGG - Intronic
1187981276 X:24760237-24760259 TTTCACAAATTGCAGATAGATGG + Intronic
1188054398 X:25524685-25524707 TTTAAGACAATGATGGGAGAGGG - Intergenic
1189544067 X:42023522-42023544 TTTTACTCATTTATGGTATAGGG - Intergenic
1193079178 X:77389143-77389165 TTTCTTACATGGATGGTAGCAGG - Intergenic
1193842268 X:86420989-86421011 TTTCAGGAACTGATGGTAGAAGG + Intronic
1193966786 X:87997580-87997602 TTTCTCACAGTCATGGTAAAAGG - Intergenic
1194307620 X:92267985-92268007 ATTCACACATTGATGGAAGATGG - Intronic
1197017028 X:121637090-121637112 TTCCATACATTGATCATAGAAGG + Intergenic
1199006325 X:142701607-142701629 TATCACACATAGATTGAAGATGG - Intergenic
1199377101 X:147125865-147125887 TTTCACAGATAGATGTTTGACGG + Intergenic
1199768722 X:150959784-150959806 TTTCACACTCTGTTGGTGGAAGG + Intergenic
1200837233 Y:7744485-7744507 ATTCACAAAATGATGGTATATGG + Intergenic
1201406025 Y:13651546-13651568 TTTGACAAATTGATGGAAGAAGG - Intergenic