ID: 1030827900

View in Genome Browser
Species Human (GRCh38)
Location 7:114184437-114184459
Sequence TTTTAGCTATAGGACATTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030827894_1030827900 9 Left 1030827894 7:114184405-114184427 CCATAAGATATGAAATTATTTAC 0: 1
1: 0
2: 0
3: 34
4: 469
Right 1030827900 7:114184437-114184459 TTTTAGCTATAGGACATTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030827900 Original CRISPR TTTTAGCTATAGGACATTGG GGG Intronic
No off target data available for this crispr