ID: 1030830192

View in Genome Browser
Species Human (GRCh38)
Location 7:114210773-114210795
Sequence ATGGCGGCTGCCACTCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030830187_1030830192 22 Left 1030830187 7:114210728-114210750 CCAAAGCCAGCAGGCTAGAATGT 0: 1
1: 3
2: 20
3: 85
4: 331
Right 1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG 0: 1
1: 0
2: 1
3: 27
4: 219
1030830191_1030830192 -10 Left 1030830191 7:114210760-114210782 CCAAACTGCAGAAATGGCGGCTG 0: 1
1: 3
2: 13
3: 29
4: 116
Right 1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG 0: 1
1: 0
2: 1
3: 27
4: 219
1030830188_1030830192 16 Left 1030830188 7:114210734-114210756 CCAGCAGGCTAGAATGTCTGAGT 0: 3
1: 6
2: 31
3: 117
4: 393
Right 1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG 0: 1
1: 0
2: 1
3: 27
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030830192 Original CRISPR ATGGCGGCTGCCACTCTCCA TGG Intronic
900083122 1:873948-873970 ACGGCGGCTGCCATTTTCCAGGG + Intergenic
900415357 1:2532162-2532184 ATGGCGGCTGGCACTGGCTAGGG + Intergenic
900494907 1:2971971-2971993 CAGGTGGCTGCCACCCTCCAAGG - Intergenic
901440075 1:9272432-9272454 ATGGCTGCTGCAGCTCACCAAGG - Intergenic
904222338 1:28982441-28982463 ATGGCAGCTGTCACTTTGCAGGG + Intronic
910602293 1:89044243-89044265 ATGGCAGCAGCCACTCTAGATGG + Intergenic
910638583 1:89436979-89437001 ATGGCAGCAGCCACTCTAGATGG - Intergenic
912393216 1:109319286-109319308 ATGTCTGCTGACAATCTCCAGGG + Intronic
916788515 1:168104372-168104394 AGGGCCCCTGACACTCTCCAGGG + Intronic
916795699 1:168165243-168165265 ATGGCGCCTTCCACTCTACCTGG + Intergenic
916933604 1:169605056-169605078 AAGGAGGTTGCCACTCACCACGG - Intronic
918839220 1:189513127-189513149 ATGGCTGCTGCCCCTCCCCCAGG - Intergenic
920147331 1:203873151-203873173 ATGGCGGCTCCCACGCTGCTTGG + Intergenic
920666701 1:207967969-207967991 ATGGCCACTGCCTCTCTTCAGGG + Intergenic
920666927 1:207969779-207969801 ATGGCCACTGCCCCTCTTCAGGG - Intergenic
922390647 1:225138090-225138112 ATGGCAGCTGCCCCTCCCCCTGG + Intronic
922765762 1:228155854-228155876 ATGGCGCCTGCCAGTGCCCATGG - Intronic
923040107 1:230313758-230313780 ATGACGGATCCCACTTTCCAAGG - Intergenic
923195531 1:231662637-231662659 ATGGTGGCTGCCCCTCTCCCTGG + Intronic
924629539 1:245724005-245724027 ATGGCGGCTGCCCCTCCCCCTGG - Intergenic
924779226 1:247131483-247131505 CTGGCTGCTGCCCCTCCCCAAGG - Intronic
1062808135 10:440325-440347 ATGGCTGCTTTCACACTCCAAGG + Intronic
1063251716 10:4281552-4281574 CTGCTGGCTGCCACTCTCCTTGG + Intergenic
1065380686 10:25087077-25087099 ATGGAGGGTGCTATTCTCCAGGG - Intergenic
1065649815 10:27875990-27876012 ATGGCGGGTGCCCCTCCCCCAGG - Intronic
1066703312 10:38152460-38152482 ATGGTGGCTGCAGCTCTCCTAGG + Intergenic
1066987471 10:42480756-42480778 ATGGTGGCTGCAGCTCTCCTAGG - Intergenic
1067180673 10:43983546-43983568 GGGGCGGCTCCCACTCACCAGGG - Intergenic
1068083250 10:52346434-52346456 ATGGCAGTGGCCACTCTGCATGG - Intergenic
1068171825 10:53404191-53404213 ACCGTGGCTGCCACACTCCAGGG - Intergenic
1069544470 10:69318746-69318768 CTGGCGGCTGTCACCCTCCAGGG + Intronic
1071317401 10:84415782-84415804 ATGGCGGCTGCCCCTCCTCCTGG + Intronic
1074901054 10:117816804-117816826 CTGGCAGCAGCCTCTCTCCAAGG + Intergenic
1075230398 10:120671486-120671508 ATGGCTGCTGCCCCTCTCCCTGG - Intergenic
1075860866 10:125675359-125675381 ATGACAGCTGCCCCTCTCCTGGG + Intronic
1077096838 11:802585-802607 ATGAGGGCTGCCACTGTGCAGGG + Exonic
1077363891 11:2153729-2153751 ATGGGGACTGCCACTTCCCACGG + Intronic
1077460933 11:2709177-2709199 ATGGAGGCTCCCACGCTCCAGGG - Intronic
1079654747 11:22974057-22974079 ATGGTGGCTGCCCCTCTCCCTGG + Intergenic
1083172128 11:60929237-60929259 AGGGCAGCTGCAAGTCTCCAGGG + Intronic
1086742008 11:90380009-90380031 ATGGTGCCTGCCCCTCCCCATGG + Intergenic
1087329031 11:96755993-96756015 ATGGTGGCTGCCCCTCCCCTCGG + Intergenic
1090734376 11:129598518-129598540 TTGGCTGCTGCCCCTCCCCAAGG - Intergenic
1091035970 11:132233920-132233942 GTGGCCCCTGCCACCCTCCAGGG + Intronic
1092241899 12:6840694-6840716 GTGGGGGCTGCCCCTCTCTATGG + Intronic
1092325544 12:7527662-7527684 GTGGCAGCTGCCACTCTCCCTGG + Intergenic
1093649558 12:21627287-21627309 ATGGCGGATGCCCCTCCCCCAGG + Intergenic
1095103154 12:38203380-38203402 ATGGCGGCTGCCATTTTCAGGGG + Intergenic
1096557385 12:52411739-52411761 ATGGCTGCTGTGACTCTCCTTGG + Intergenic
1097130145 12:56805500-56805522 ATGGCAGCGGCCACTCTAGATGG + Intergenic
1097261698 12:57724155-57724177 ATGGAGGCTGCGGCTCTACAGGG - Intronic
1097910580 12:64965476-64965498 ATGGTGGCTGCCCCTCCCCCTGG + Intergenic
1098085055 12:66833486-66833508 ATGGGGTCTGCCTTTCTCCAGGG + Intergenic
1098908320 12:76183763-76183785 ATGGTGGCAGCCTTTCTCCATGG + Intergenic
1103923335 12:124410757-124410779 ACAGCGGCTGCCCCTCCCCAGGG + Intronic
1103927611 12:124432601-124432623 CTGGCGGCTGCCCCTCCCCAGGG - Intronic
1104023729 12:125011212-125011234 ATGGGGGCTGGGACTCTGCAGGG - Intronic
1104741451 12:131177796-131177818 AGTGAGGCTGCCACACTCCAGGG - Intergenic
1106192787 13:27468583-27468605 ATGGTACCTGCCAATCTCCATGG - Intergenic
1106330958 13:28739183-28739205 GTGGCGGCTGCTATTCACCAGGG + Intergenic
1111332822 13:86782314-86782336 ATGGCAGCTGCCCCTCCCCCTGG + Intergenic
1112417908 13:99219124-99219146 ATGGCGGCTCCTCCTCTCAAGGG + Intronic
1113081853 13:106528684-106528706 ATTGCGGATGTCACTCTGCATGG + Intronic
1116153823 14:41177579-41177601 ATGATGGCTTCCACTTTCCAAGG - Intergenic
1118478860 14:66143855-66143877 CTGGCTGCTGCCCCTCCCCAAGG - Intergenic
1121680882 14:95791809-95791831 ATGGGAGCTGCCACCCCCCATGG - Intergenic
1122155083 14:99746046-99746068 ATGGCGGCTCCCCCTCCCCTAGG + Intronic
1123463045 15:20492180-20492202 TTGGAGGCTGCCCCTCCCCACGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124464667 15:29926008-29926030 CTGGCGGCTCCCTCCCTCCAAGG - Intronic
1124923477 15:34048303-34048325 ATGGCGGCTGCCCCTCCCTCTGG - Intronic
1124923531 15:34048567-34048589 ATGGCGGCTGCCCCTCCTCCTGG - Intronic
1125216613 15:37282918-37282940 ATGGCAGCTGCCCCTCCCCCTGG + Intergenic
1127012157 15:54642618-54642640 ATGGCAGCTGCCCCTCCCCCAGG - Intergenic
1128322744 15:66704189-66704211 CTGGTGGCTCCCACGCTCCAAGG - Intronic
1129838515 15:78729046-78729068 CTGGTGGCTGCCACTCACCTGGG + Intergenic
1132036588 15:98490514-98490536 CTGGGGACTGCCTCTCTCCAAGG - Intronic
1132652298 16:1027011-1027033 CTGGCGGCTGCCGCTGTCCTGGG - Intergenic
1133381792 16:5337019-5337041 AGTGCAGCTGCCATTCTCCAGGG - Intergenic
1133583383 16:7167772-7167794 ATGGCTGCTTTCACTCTGCAAGG + Intronic
1136392354 16:29973750-29973772 TTGGCGGCTGCCGGTCTCCCAGG + Exonic
1138023344 16:53503567-53503589 AGGGCGTCTGCCAGTCACCACGG + Intronic
1139618205 16:68113959-68113981 ATGGCGACTGCCCCTTTCCGTGG + Intronic
1140456045 16:75106167-75106189 GTGGCTGCTGCCATTCTCCTGGG + Intronic
1140941449 16:79725240-79725262 CTGGAGGCTTCAACTCTCCAAGG + Intergenic
1141813310 16:86391336-86391358 ATAGCGTTTGCCAGTCTCCATGG - Intergenic
1141968933 16:87466827-87466849 GTGATGGCTTCCACTCTCCATGG + Intronic
1142617624 17:1145719-1145741 CTGGCTGCTGCCACCCTGCAGGG - Intronic
1144710217 17:17396594-17396616 ACGTCGGCTGGCATTCTCCAGGG - Intergenic
1148849201 17:50546630-50546652 CTGCCGCCTGCCACTCTGCAAGG - Intronic
1151023973 17:70655769-70655791 ATGGCTGCTTCCAAACTCCAAGG - Intergenic
1155830984 18:30514332-30514354 ATGGCAGCAGCCACTCTAGATGG - Intergenic
1157544322 18:48537415-48537437 AAGGCCCATGCCACTCTCCATGG + Intergenic
1157567114 18:48686789-48686811 ATGGAGGCTGCAAATCTCCGAGG - Intronic
1157796693 18:50581413-50581435 ACGGCAGCTGCCTCCCTCCAGGG + Intronic
1159685468 18:71413672-71413694 ATGGTGGGTGCCACCATCCAGGG + Intergenic
1160097734 18:75890549-75890571 TTGGAGGCTGCTGCTCTCCATGG + Intergenic
1161025199 19:2033618-2033640 CTGGGGGCTGCCACTGTCCAGGG + Intronic
1161087234 19:2340788-2340810 GTGGGGGCTGCCACTCTGCAGGG + Intronic
1161373058 19:3924346-3924368 ATTGAGGTTGCCAGTCTCCAGGG + Intronic
1161515218 19:4692659-4692681 GCTGCAGCTGCCACTCTCCAGGG - Intronic
1162337425 19:10070589-10070611 AGGGTGGCTGACAGTCTCCAAGG - Intergenic
1163468571 19:17483893-17483915 ATGCCGCCTGCCTCTCTCAAGGG + Intronic
1164121056 19:22265828-22265850 ATGGCTGCTGCCCCTCCCCAAGG - Intergenic
1164599714 19:29552660-29552682 ATGACAGCTGCCCCTCTCCCCGG - Intronic
925442322 2:3899339-3899361 ATGGTGGCTGCCCCTCCCCCTGG + Intergenic
928422897 2:31153457-31153479 CTGGTGGCTGACACTGTCCAAGG + Intronic
931507020 2:62939890-62939912 ATGGCTGTTGGCTCTCTCCAAGG + Intronic
931560392 2:63555095-63555117 ATGGCTGCCGCCCCTCTCCCTGG - Intronic
932379582 2:71269909-71269931 ATGGCAGCTGCCCCTCCCCATGG - Intergenic
932656912 2:73618350-73618372 AAGGCTGATTCCACTCTCCAAGG + Intergenic
933089541 2:78103988-78104010 AAGGGGGCTGCCCCACTCCATGG + Intergenic
935273015 2:101451237-101451259 AAGGGGGCTGCCACTCACCAAGG - Intronic
937180682 2:119993441-119993463 ATGGCAGCTGTCACTTTGCAGGG + Intergenic
937507242 2:122551136-122551158 ATGGCGGGTGCCCCTCCCCCAGG - Intergenic
937991427 2:127664385-127664407 AAGGCGGCTGCCCCGCGCCATGG - Exonic
940615853 2:156047842-156047864 TTGGCTGCTGCCCTTCTCCAAGG - Intergenic
940792639 2:158044517-158044539 ATTCCGGCTGCCACACTCCCAGG - Intronic
940932439 2:159449573-159449595 ATGGTAGCTGCCAGTCTCAAAGG + Intronic
942121870 2:172785928-172785950 AAGGCGGTGGGCACTCTCCACGG + Intronic
945076063 2:206040582-206040604 ATGGCAGCTGTCACTTTGCAGGG - Intronic
948456335 2:238106278-238106300 ATGGCGCCTGCTGCTCACCATGG + Intronic
948757387 2:240167497-240167519 ATGGAGGCCGCCACTGCCCAGGG - Intergenic
1170011445 20:11728250-11728272 ATGGTGGCTGCCACTCCCCCAGG - Intergenic
1172095020 20:32456364-32456386 ATTGCCGCTGCCACTCTCAGAGG + Exonic
1173388023 20:42606472-42606494 ATGGCGGCTGTCATTCCCCCAGG - Intronic
1173488387 20:43458183-43458205 GTGGCGGCGGGAACTCTCCAAGG + Intronic
1173592227 20:44233756-44233778 AAAGAGGCTGCCACTCACCAGGG + Intergenic
1173593673 20:44245095-44245117 AAAGTGGCTGCCACTCACCAGGG - Intergenic
1174123750 20:48287672-48287694 ATGCCTGGTGCCACACTCCATGG + Intergenic
1177388085 21:20433193-20433215 ATGGTGGCTGCCCCTCTCCCTGG - Intergenic
1178663793 21:34529154-34529176 ATGGTGGCTGCCACTTTGTAGGG + Intronic
1178701363 21:34835948-34835970 ATGATGGCTGCAAATCTCCATGG + Intronic
1179382418 21:40911625-40911647 TTGGCTGCTGCCCTTCTCCAGGG + Intergenic
1181498013 22:23298976-23298998 CTGGGGCCTGCCCCTCTCCAAGG + Intronic
1182978611 22:34646898-34646920 CCAGCGGCTGCCACTCTCCTGGG - Intergenic
1183745254 22:39688147-39688169 CTGGCTGCTTCCCCTCTCCAGGG - Exonic
1184287110 22:43477950-43477972 ATGACCACAGCCACTCTCCAGGG - Intronic
1184819241 22:46896549-46896571 ATGGGGACTGCCACTGTCCCAGG - Intronic
1184881290 22:47306000-47306022 TGGGCAGCTGCCACTCTGCAGGG + Intergenic
1185284455 22:49994100-49994122 ATGCAGGCTGCCACTCGCCCAGG - Intergenic
949444125 3:4115213-4115235 CTGGGGGCAGCCAGTCTCCAGGG + Intronic
953913682 3:46905209-46905231 ATGTCCGATGCCACTCTCTAGGG + Intergenic
954529281 3:51304344-51304366 ATGCCTGCTGCCCCTCTCCTGGG + Intronic
954696302 3:52429038-52429060 ATGGCGACTGCCAGTCCCAAGGG + Intergenic
956386500 3:68725213-68725235 ATGGCAGCTGCCTCTCCCCCTGG + Intergenic
958418553 3:93906360-93906382 TTGGCAGCGGCCACTCTACATGG - Intronic
961415680 3:126754925-126754947 GTGGCTGCTGCCAGTCTCCTGGG + Intronic
961464358 3:127072364-127072386 ATGGCAGCTCCCACTGTCCCTGG - Intergenic
966840258 3:184082186-184082208 ATGGCTGCTGGCTCTCTGCAAGG - Intergenic
967735094 3:192943373-192943395 AAGGAGGCTGGCGCTCTCCAAGG + Intergenic
968357469 3:198120378-198120400 ATGGCGGCTGCCATTTTCCAGGG + Intergenic
969313877 4:6370113-6370135 AGGGTGGCTGCCACTGTCCCAGG + Intronic
969704114 4:8782789-8782811 ATGGGGCCTGCCACCCACCAGGG + Intergenic
970668534 4:18366982-18367004 ATTGTGGCTCCCACTCTCCAAGG + Intergenic
975053380 4:69894911-69894933 ATGGGGACTCCCACTTTCCAGGG + Intergenic
975974364 4:80078369-80078391 ATGTGGGCTTCCACTCTACAGGG + Intronic
977569887 4:98617980-98618002 ATGGCATCTGCCACTGTCCTTGG + Intronic
979663322 4:123283787-123283809 ATGGCTGCTTCCACACTGCAAGG + Intronic
979732846 4:124045489-124045511 ATGGCAGCTGCCACTTCCCTAGG + Intergenic
980184617 4:129446285-129446307 TTGGCTGCTGCCCCTCCCCAAGG - Intergenic
980306407 4:131065704-131065726 ATGGCAGCAGCCACTCTAGACGG + Intergenic
984492524 4:180453320-180453342 ATGACAGCTGCAACTCTCCGGGG - Intergenic
985441070 4:189982872-189982894 ACGGCGGCTGCCATTTTCCAGGG - Intergenic
985697502 5:1349039-1349061 GGGGAGGCTGCTACTCTCCAGGG + Intergenic
985795705 5:1960380-1960402 GTGGCAGCTGCCACTCCACACGG + Intergenic
986011937 5:3724658-3724680 ATGGCGGCTGCTCCTCCCCCTGG + Intergenic
986601179 5:9474682-9474704 ATGGCTGCTTCCACTCTGTATGG + Intronic
986915403 5:12613543-12613565 ATGGTGGCTGCCCATCCCCATGG + Intergenic
987123957 5:14793624-14793646 ATGGTGGCTGCAAATCTCAATGG + Intronic
993370325 5:87084852-87084874 ATGGCGGATGCCCCTCACCCAGG - Intergenic
993493975 5:88586778-88586800 ATGGCAGCTGCCCCTCCCCCTGG - Intergenic
993494017 5:88587040-88587062 ATGGTAGCTTCCACTCTCCCTGG - Intergenic
993837681 5:92835252-92835274 ATGGTGGCTGCCTCTCTCTTGGG + Intergenic
995264193 5:110139029-110139051 ATGGCTGCTGTCCCTCTCCTGGG + Intergenic
996934715 5:128935392-128935414 ATGGGGTCTTCCACTCTGCATGG - Intronic
1000719854 5:164693195-164693217 ATGGTGGCTGCCCATCTCCCTGG - Intergenic
1001964504 5:175900840-175900862 ATGAGGGCAGCCCCTCTCCATGG - Intergenic
1003049299 6:2765602-2765624 ATGGCGGCCGCCGCCCTCCCCGG - Exonic
1005395417 6:25377486-25377508 AGTGGGGCTGCCACACTCCAGGG + Intronic
1005514419 6:26540262-26540284 ATGGTGTCAGTCACTCTCCAGGG - Intronic
1006633108 6:35443384-35443406 ATGGCGGCGACCCCACTCCAGGG - Intergenic
1012093689 6:94931965-94931987 ATGGCAGCTTCCCCTCCCCAGGG + Intergenic
1012122228 6:95383798-95383820 ATGGCAGCAGCCACTCTACATGG - Intergenic
1012142668 6:95643064-95643086 ATGGCAGCTGCCCCTTCCCATGG - Intergenic
1016704146 6:147087599-147087621 ATGGAGACTGCAACTCTCCCTGG + Intergenic
1016759013 6:147716689-147716711 ATGGCAGCAGCCACTCTAGATGG + Intronic
1018828088 6:167423041-167423063 CTGGCGGCTCCCCCTCTACACGG + Intergenic
1019446875 7:1075971-1075993 CCCGGGGCTGCCACTCTCCAGGG + Intronic
1019930356 7:4218713-4218735 ACGGTGGGTGCCACTCACCAAGG + Intronic
1020238424 7:6374336-6374358 ATGGCGGCTGCCACGCCCCGCGG + Intergenic
1020586625 7:10078422-10078444 ATGGCAGCAGCCACTCTAGATGG - Intergenic
1023043528 7:36193154-36193176 ATGCCTGCTGCCAATGTCCACGG - Intronic
1023117864 7:36880033-36880055 GTGGGGGCTGCCTCTCCCCACGG + Intronic
1023453600 7:40314400-40314422 ATGGCGAATGTCACTCTCTAAGG - Intronic
1023666381 7:42527233-42527255 ATGGCAGCTGCCCCTCCCCCTGG - Intergenic
1024034416 7:45495338-45495360 ATGGCAGCCGCCCCTCCCCACGG + Intergenic
1026763497 7:73144278-73144300 TTGACGGGTGCCTCTCTCCATGG - Intergenic
1027039967 7:74954052-74954074 TTGACGGGTGCCTCTCTCCATGG - Intergenic
1027083672 7:75248312-75248334 TTGACGGGTGCCTCTCTCCATGG + Intergenic
1028177043 7:87671845-87671867 ATGGTGCCTGCCACTCCCCCTGG + Intronic
1028336739 7:89667369-89667391 ATGGCCACTGCCACTATCCCTGG + Intergenic
1028785020 7:94782968-94782990 ATGGCCGCTTCCATTCTGCACGG + Intergenic
1030578419 7:111319861-111319883 ATTTCGGCTGCCACATTCCATGG + Intronic
1030830192 7:114210773-114210795 ATGGCGGCTGCCACTCTCCATGG + Intronic
1034642541 7:152615578-152615600 TTGGCCTCTGCCACTCTCCCAGG - Intergenic
1035599582 8:889721-889743 CTGGCTGCTGCCCCTCCCCAGGG + Intergenic
1036777958 8:11626594-11626616 CTGGTGGCTGCCCCTCACCACGG + Intergenic
1037582427 8:20253487-20253509 CTGGTGGCTGGCACTCTCCGGGG + Exonic
1037777911 8:21847853-21847875 TTGCCTGCTGCCACCCTCCATGG + Intergenic
1038073223 8:24041406-24041428 ATGGTGGCTGCCAGTGTCTAGGG - Intergenic
1038630810 8:29242027-29242049 GTGGAGGCTCCCACTCTCCATGG + Intronic
1041191587 8:55361063-55361085 AGGGCAGCAGCTACTCTCCACGG + Intronic
1041963468 8:63647286-63647308 ATGAGGGCTGCAACTCTGCAAGG - Intergenic
1042342763 8:67697243-67697265 CTGGGGGCTGCTGCTCTCCACGG + Intronic
1043092548 8:75924131-75924153 ATGGTGGCTGCCCCTCCCCCCGG - Intergenic
1044328545 8:90889626-90889648 ATGGCTGCTGACACATTCCAAGG + Intronic
1044409221 8:91866865-91866887 ATGGCAGCAGCCACTCTGGATGG - Intergenic
1044873362 8:96641805-96641827 ATGGTGGTTGTCCCTCTCCAAGG + Intergenic
1045244703 8:100432857-100432879 ATGGTAGATGCCACTCGCCAGGG - Intergenic
1045585405 8:103529323-103529345 ATGGCGGGTGCCCCTCCCCCAGG + Intronic
1045890495 8:107150907-107150929 CTGGTGGCTTCTACTCTCCATGG - Intergenic
1047206579 8:122807073-122807095 ATAGCAGCTCCCACTCACCAAGG - Intronic
1047233658 8:123019504-123019526 ATGAGGCCTGCCACTCTTCAAGG + Intronic
1048970507 8:139642813-139642835 ATGGGGGCCGCCACTCTCCCTGG - Intronic
1050320711 9:4449259-4449281 ATGGCAGATGCCCCTCTCCCTGG - Intergenic
1051508945 9:17856490-17856512 AGGGCAGGTGACACTCTCCATGG - Intergenic
1052699871 9:31924664-31924686 ATGGCAGCTGTTCCTCTCCAGGG + Intergenic
1056042521 9:82682880-82682902 ATGGCTGCTGCCAGTTTCCTTGG - Intergenic
1056733505 9:89185191-89185213 CTGGGGGCTGCCTCTCCCCATGG - Intergenic
1058530392 9:105900364-105900386 ATGGTGGCTGCCCCTCCCCCTGG + Intergenic
1058707922 9:107652536-107652558 GTGGTGGCTGCCAATCTCCTTGG + Intergenic
1061584065 9:131555025-131555047 AGGGCGGCGGCCACTCACCACGG - Intergenic
1062741321 9:138176863-138176885 ACGGCGGCTGCCATTTTCCAGGG + Intergenic
1186741053 X:12518137-12518159 ATGGCCGCTGCCCTTCTCCATGG + Intronic
1189037200 X:37505458-37505480 ATAGCGGCTGAAGCTCTCCAGGG - Intronic
1189652325 X:43203700-43203722 ATGGCAGCTGCCCCTCCCCCTGG + Intergenic
1191768859 X:64733214-64733236 ATGGCTGCTGCCACTCCCCTTGG + Intergenic
1192503183 X:71666308-71666330 AGGCCTGCTGCCATTCTCCAGGG + Intergenic
1192503625 X:71668259-71668281 AGGCCTGCTGCCATTCTCCAGGG - Intergenic
1192522838 X:71816504-71816526 AAGGAGGCATCCACTCTCCATGG - Intergenic
1193625864 X:83819465-83819487 ATGGCGGCTGCCCCTCCCACTGG + Intergenic
1193857024 X:86615728-86615750 ATGGCTGCTGTCACTCTATAAGG - Intronic
1194264016 X:91733687-91733709 ATGGCAGCTGCCCCTCTCCCTGG + Intergenic
1195634644 X:107100279-107100301 ATGGCGTGTGCCACTGTCCCTGG + Intronic
1199215043 X:145253285-145253307 CTGGTGGCTGCCACTCAACAGGG - Intronic
1200053002 X:153444676-153444698 GTGGAGGCTGGCACTGTCCATGG + Intergenic
1201159991 Y:11159050-11159072 ATGGTGTCTGCCACCCACCAGGG + Intergenic