ID: 1030832823

View in Genome Browser
Species Human (GRCh38)
Location 7:114247836-114247858
Sequence GTACCTGGGTATATTAGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 45}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030832823 Original CRISPR GTACCTGGGTATATTAGTCG GGG Intronic
901747723 1:11385551-11385573 GTTCCTGGCTGTATTAGTCAGGG + Intergenic
901778316 1:11575764-11575786 ATACCTGCCTATATTAGTCAGGG + Intergenic
904452959 1:30628202-30628224 GAAGCTGGGTATATGAGTCTGGG + Intergenic
919500074 1:198327341-198327363 GAACCTGGGTAAAATATTCGTGG - Intergenic
1068531069 10:58187240-58187262 TTACCTGGGTATATTATACTGGG + Intergenic
1080248928 11:30210838-30210860 GTACCTGGGTATATATGTTCAGG - Intergenic
1090913798 11:131144775-131144797 GTTCCTGGGTATATTTAGCGAGG - Intergenic
1092980089 12:13786153-13786175 GTACCTGCTTAGTTTAGTCGAGG - Intronic
1099830967 12:87842271-87842293 GTACCTGGATAAATTACTCTGGG + Intergenic
1102889568 12:116547831-116547853 GTACATGGATATATTTGTGGGGG + Intergenic
1110334551 13:74312097-74312119 GAACCTTGGTGTATTAGTCAGGG - Intergenic
1113169377 13:107482388-107482410 GCCCCTGGGTGTATTAGTCGAGG - Intronic
1144366590 17:14550469-14550491 GTAACTGGGTATATTAATCAGGG + Intergenic
1158340743 18:56463328-56463350 TTACCTGGGTATATTACATGAGG - Intergenic
1159147713 18:64476034-64476056 GTACATGTGTATATCAGTTGAGG - Intergenic
926782331 2:16484825-16484847 GTAGCTGGGTGTATCAGTCAGGG - Intergenic
928462405 2:31486533-31486555 GTACCTGGATATTTTAGTTGAGG + Intergenic
944492517 2:200272315-200272337 TTGCCTGAGTATATTAGTCAAGG + Intergenic
945219168 2:207466722-207466744 GTAACTGGGTCTATCAGTCAGGG + Intergenic
947230068 2:227875564-227875586 GTCCATGGGTAGATTATTCGAGG - Intronic
947264823 2:228266936-228266958 TTCCCTTGGCATATTAGTCGAGG - Intergenic
1176701385 21:10055616-10055638 GTATCTCAGTATATTAGTCAGGG + Intergenic
1178471349 21:32895765-32895787 GTAACAGAGTATATTAGTCAGGG - Intergenic
949453278 3:4211254-4211276 GTACCTGGGTATATTAGTCAGGG - Intronic
952206430 3:31185289-31185311 GGACCTGGATATCTTAGTGGGGG - Intergenic
961298817 3:125908433-125908455 TTACCTGGGTATAGTAGTGTGGG + Intergenic
966563844 3:181353770-181353792 GTACCTTTGTATATTAGCAGTGG + Intergenic
968753103 4:2400508-2400530 TTGCCTGGGTATATTAGTCAGGG + Intronic
974311888 4:60222923-60222945 GTTCCTGTGTATATAAGTCCAGG - Intergenic
976562097 4:86513521-86513543 GTACCTGGGTATATTCCTCTGGG + Intronic
977266648 4:94863398-94863420 GTTCTTGAGTATATCAGTCGAGG + Intronic
980373539 4:131911875-131911897 GTATCTCAGTATATTAGTCAGGG + Intergenic
987870371 5:23610163-23610185 ATTCTTGGGTATATTAGTCAGGG + Intergenic
989985667 5:50694635-50694657 GTACCTGGCTGTATTAGTCTGGG + Intronic
991299924 5:65120315-65120337 AAACATGGGTATATTAGTCAAGG + Intergenic
995251887 5:110002815-110002837 GAACCTGGGTATGTTAGTCAGGG + Intergenic
995647545 5:114329755-114329777 GGAGCTGGGTGTATTAGTCAGGG - Intergenic
1003805233 6:9720849-9720871 GTTGCTGGGAATATTGGTCGTGG - Intronic
1004707565 6:18138619-18138641 TTACCTGGTAATATTAGTGGAGG + Intronic
1008572684 6:52830417-52830439 GAACCTGGGTATATGAGACTGGG - Intergenic
1009328730 6:62387692-62387714 GTCCCTGAGTATATTATTCTAGG + Intergenic
1016492326 6:144620316-144620338 ATGCCTGGGTAAATTAATCGGGG + Intronic
1017310898 6:152976505-152976527 GTTCTTTGGTAAATTAGTCGTGG - Intronic
1026165223 7:67903545-67903567 CTACCTGCCTATATTAGTCAGGG + Intergenic
1027211991 7:76157124-76157146 GTATCTGTGTATATTTGTTGGGG - Intergenic
1028567557 7:92249276-92249298 CTACCAGGGTAAATTAGTCAAGG + Intronic
1029171895 7:98636422-98636444 TTACGTGAGTGTATTAGTCGGGG - Intergenic
1030832823 7:114247836-114247858 GTACCTGGGTATATTAGTCGGGG + Intronic
1046604857 8:116360121-116360143 GTATTTGTGTATATTAGTAGTGG - Intergenic
1054319323 9:63638702-63638724 GTATCTCAGTATATTAGTCAGGG + Intergenic
1058090835 9:100803709-100803731 GTTCCTGGGTATATCTGTGGGGG - Intergenic
1058982170 9:110180292-110180314 CTAGCTGGGTATAGTAGTGGGGG + Intergenic
1202786402 9_KI270719v1_random:25699-25721 GTATCTCAGTATATTAGTCAGGG + Intergenic
1197356306 X:125440110-125440132 GTACCTTGGTATCTTGGACGAGG + Intergenic