ID: 1030832939

View in Genome Browser
Species Human (GRCh38)
Location 7:114249367-114249389
Sequence TGGGGCCTACTGGGGGGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 0, 3: 73, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030832939_1030832949 7 Left 1030832939 7:114249367-114249389 CCCGTTCCCCCCAGTAGGCCCCA 0: 1
1: 0
2: 0
3: 73
4: 528
Right 1030832949 7:114249397-114249419 TTGTTCCCCTCCCTGTGTCCAGG 0: 13
1: 56
2: 339
3: 249
4: 435

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030832939 Original CRISPR TGGGGCCTACTGGGGGGAAC GGG (reversed) Intronic
901630311 1:10644803-10644825 TGGAGCCTGCGGTGGGGAACAGG + Intronic
906842686 1:49157237-49157259 TGGGGCCTTCTGGGGGGTGGGGG - Intronic
908204546 1:61832162-61832184 TGGGGCCTACTTGGGGGTAGAGG + Intronic
908819846 1:68074196-68074218 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
908981323 1:69962811-69962833 TGGGGCCTACTGGAGGACAGAGG + Intronic
909398405 1:75196370-75196392 GGGGGCCAACTGGGTGGTACTGG + Intergenic
910415136 1:86989723-86989745 TGGGGCCTGCTGGGGGCTAGGGG - Intronic
910570726 1:88699579-88699601 TGGGGCCTACTGGAGGGTGGGGG - Intronic
911478937 1:98411895-98411917 TGGGGCCTACTTGAGGGTACAGG - Intergenic
912404960 1:109429478-109429500 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
913320698 1:117586588-117586610 TGTGGCCTACTGGGGAGAAGAGG + Intergenic
914398454 1:147292843-147292865 TGGGGCCTAGTGGGAGGTATTGG - Intronic
914858862 1:151370683-151370705 TGGGGCCTGCTGGGGAGCAGGGG + Intronic
915763971 1:158344281-158344303 TGGGGCCTATTGGAGGTTACAGG - Intergenic
916441464 1:164829612-164829634 TGGGGCCTGTTGAGGGGAAGAGG + Intronic
916602882 1:166311034-166311056 TGGGGCCTACTGTGGGGTAGGGG - Intergenic
917179034 1:172273838-172273860 TGGGGACTACTGGGGTACACAGG - Intronic
917393707 1:174568291-174568313 TGGGGCCTAGTGGGAGGTACTGG - Intronic
917997855 1:180460134-180460156 CGGGGCCTACTGTGGGGTAGGGG - Intronic
918581992 1:186142158-186142180 TGGGGCCTACTTGAGGGAGGAGG - Intronic
918803985 1:189015607-189015629 TGGGGCCCACTTGAGGGTACAGG - Intergenic
919189666 1:194200470-194200492 TGGGGCCTATTGTGGGGTAGGGG - Intergenic
919489937 1:198194449-198194471 TGGGGCCTACTGGAGGGTGAAGG - Intronic
921852876 1:219949595-219949617 TGGGGACTGTTGGGGGGAGCGGG + Intronic
922209361 1:223475910-223475932 TGGGGGCTCCTGGGTGTAACGGG - Intergenic
922650851 1:227337005-227337027 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
923188394 1:231596377-231596399 AGGGGCCTACTCTGGGGGACAGG - Intronic
923431154 1:233921798-233921820 TGGGGCCTGTTGGGGGGAGGGGG - Intronic
923985108 1:239373052-239373074 TGGGGCCTACTCTGGGGTAAAGG - Intergenic
924855855 1:247874425-247874447 TGGGGCCTAGTGGGGGGTGCTGG - Intronic
1064721786 10:18236498-18236520 GGGGGCCTACTGAGGGGCTCTGG - Intronic
1064799744 10:19055835-19055857 TGGGGACTACTGAAGGGAAGAGG + Intronic
1064856694 10:19776268-19776290 TGGGGCCTCGTGGGAGGCACTGG - Intronic
1064912179 10:20414878-20414900 TGGGGCCTACTGGTGGGGTAGGG + Intergenic
1065169766 10:23014791-23014813 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1065860421 10:29867884-29867906 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1066160222 10:32720410-32720432 TGGGGCCTGTTGGGGGGTAGGGG + Intronic
1066297055 10:34063524-34063546 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1066645479 10:37603395-37603417 TGGGGCCTACTTGAGGGTAAAGG + Intergenic
1067118318 10:43452694-43452716 TGAGGCTTTCTGGGGAGAACAGG - Intronic
1067945919 10:50687788-50687810 TGGGGCTGACTGGGGGGCTCTGG + Intergenic
1068441592 10:57062394-57062416 TGGGGCTTACTGGAGGGCAGAGG + Intergenic
1069093132 10:64226438-64226460 TGGGGCCTACTGGGGAGTGGGGG - Intergenic
1070413466 10:76166471-76166493 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1070867435 10:79714664-79714686 TGGGGCTGACTGGGGGGCTCTGG + Intronic
1070881227 10:79852788-79852810 TGGGGCTGACTGGGGGGCTCTGG + Intergenic
1071001475 10:80835926-80835948 TGGGGCCTGTTGGGGGGTAGAGG - Intergenic
1071170928 10:82863013-82863035 TGGGGCCTGTTGGGGGGTAAGGG - Intronic
1071634349 10:87236887-87236909 TGGGGCTGACTGGGGGGCTCTGG + Intronic
1071647800 10:87369104-87369126 TGGGGCTGACTGGGGGGCTCTGG + Intronic
1071668447 10:87584133-87584155 TGGGGCCTGCTGGGGGTGATGGG - Intergenic
1071863648 10:89701737-89701759 TGGGGCCTAAGGTGGGGAAACGG + Intronic
1072357813 10:94628908-94628930 TGGGGCCTGTTGGGGGCAAGGGG - Intergenic
1072609404 10:97006626-97006648 TGGGGCCAACTGTGTGGACCAGG - Exonic
1073374781 10:103023634-103023656 TGGGGCCTAGTGAGAGGTACTGG - Intronic
1073863727 10:107776536-107776558 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1074336318 10:112580088-112580110 TGGGGCCTAGAGGTGGAAACTGG + Intronic
1075300421 10:121317550-121317572 TGTGTCCTACTGGTGGGAATGGG - Intergenic
1075385943 10:122055546-122055568 TGGGGCCTATTGGAGGGAGGAGG + Intronic
1076341976 10:129755549-129755571 TGTGGCTTCCTGGGGGGAAGGGG - Intronic
1077161087 11:1113192-1113214 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161107 11:1113238-1113260 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161127 11:1113284-1113306 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161147 11:1113330-1113352 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161167 11:1113376-1113398 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077161187 11:1113422-1113444 TGGGGCCTGCTCTGGGGAAGGGG - Intergenic
1077358732 11:2130369-2130391 TGGAGCCTCCTGGGGGGCACTGG - Intronic
1077737030 11:4801945-4801967 TGGGGCCTAGTGGGAGGGATTGG - Intronic
1077792806 11:5460227-5460249 TGGGGCCTACTGGAGGGTGAAGG + Intronic
1079098452 11:17526290-17526312 AGGGGCCTGCTGGGGTGCACTGG + Intronic
1079434437 11:20433209-20433231 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1079623357 11:22583265-22583287 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1081842217 11:46210873-46210895 TGGGGACTACTAGGGGGAGGAGG - Intergenic
1082740702 11:56907888-56907910 TGGGGCCTGTTGGGGGGTGCGGG - Intergenic
1082875751 11:57986652-57986674 TGGGGCCTATTGGGGGGTGAGGG - Intergenic
1083097767 11:60269061-60269083 TGGGTCCTACTGGAGGGTAGAGG - Intergenic
1083102291 11:60320927-60320949 TGGGGTCTACTGGTGGGCATAGG - Intergenic
1083878439 11:65536898-65536920 AGGGGGCTACTGGGGGGAAGGGG - Intronic
1083938184 11:65881271-65881293 TGGGGCCTTGTGGGGGCTACAGG + Intronic
1084450171 11:69232047-69232069 TGGGGACTTCTGGGGGGTGCTGG + Intergenic
1084859154 11:72006875-72006897 TGGGGCATGCTGGGAGGCACAGG + Intronic
1085057890 11:73418237-73418259 TGGGGCCTGCTGGGAGGTACTGG + Intronic
1086311305 11:85538828-85538850 TGGGGCCTGTTGAGTGGAACAGG + Intronic
1086381334 11:86258100-86258122 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1086566517 11:88232583-88232605 TTGGGCATACTGAGGGGAAAAGG + Intergenic
1087311668 11:96551001-96551023 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1087556602 11:99729452-99729474 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1087627317 11:100609985-100610007 TGGGGCCTGTTGGAGGGAAGGGG + Intergenic
1087842819 11:102937507-102937529 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1088750692 11:112839877-112839899 GGGGGGCTGCTGGGGGGAGCTGG + Intergenic
1089033185 11:115355452-115355474 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1090554821 11:127862929-127862951 TGGGGCCTGCTGGGGGGTTGGGG - Intergenic
1090591435 11:128274364-128274386 TGGAGCCTACTGGAGGGTAGAGG - Intergenic
1090728268 11:129547018-129547040 TGGGGCCTAGTGGGAGGTATTGG + Intergenic
1092726507 12:11491517-11491539 TGGGGCCTACTGGGGGGTGTCGG + Intronic
1093344285 12:18021977-18021999 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
1093686033 12:22054881-22054903 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1094773176 12:33689982-33690004 TGGGGCCTATTGGAGGGTAAAGG + Intergenic
1095614298 12:44170282-44170304 TGGGGCCTGCTGGGGGGTGGGGG + Intronic
1096136956 12:49210552-49210574 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1096571297 12:52524751-52524773 AGGGGCCTGCTGGAGGGAAGCGG - Intergenic
1096765640 12:53886623-53886645 TGGGGCCTGTTGGGGGGTAGAGG + Intergenic
1097224112 12:57467028-57467050 TGGGGTCATCTTGGGGGAACGGG - Intronic
1097299350 12:58001915-58001937 TGGGGCCTGCTGGGGGGTGCAGG - Intergenic
1097480499 12:60118269-60118291 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
1097696907 12:62783572-62783594 TGAGGCCCAGTGAGGGGAACTGG - Intronic
1097874807 12:64633318-64633340 TGGGGCCTAGTGGGAGGTATTGG + Intronic
1097950396 12:65420631-65420653 TGGGGCCTACTTGAGGGAGCAGG - Intronic
1098798867 12:74927292-74927314 TGGGGCCTACAAGGGGGTGCAGG + Intergenic
1099603234 12:84768303-84768325 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
1099827676 12:87799137-87799159 TGGGGCCTACTTGAGGGTACAGG - Intergenic
1099833548 12:87876835-87876857 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1100087652 12:90931009-90931031 TGGGGCCTGTTGGGGGGTATGGG + Intronic
1100928620 12:99580182-99580204 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1101007187 12:100412405-100412427 TGGGGCCTGCTAGGGGGCAAGGG + Intronic
1102392854 12:112563532-112563554 TGAGGAATACTGGGGGGGACTGG - Intergenic
1102775575 12:115515778-115515800 TGGGGTCTCCTGGTGGGAAGTGG + Intergenic
1103186908 12:118966185-118966207 TGGGGCCTATCGGGGGGTAGGGG - Intergenic
1103233184 12:119349660-119349682 CAGGGACTACTGGGGTGAACAGG - Intronic
1103248195 12:119476586-119476608 TGGGGCTTAGTGTGGGGAATGGG - Intronic
1103863330 12:124031495-124031517 TGGGGCCTATTGGTGGGGACAGG - Intronic
1103909822 12:124345985-124346007 TGGGGCCGCCTGGGGGGACTGGG + Intronic
1104051493 12:125197157-125197179 TGGGGCCTACAGGAGGGTGCAGG - Intronic
1104518284 12:129448377-129448399 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1104576466 12:129971140-129971162 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1104641819 12:130471913-130471935 TGGGGCCTACGGAGGGCAATGGG + Intronic
1104652885 12:130549513-130549535 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1105241178 13:18610527-18610549 TGGGTGCTACTGGGGTGCACAGG + Intergenic
1105526727 13:21184827-21184849 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1106349115 13:28910542-28910564 TGGGGCCTGCTGGGGGGCTGGGG - Intronic
1106701152 13:32230223-32230245 TGGGGCCTACTGGAGGGCGGAGG - Intronic
1107877360 13:44802572-44802594 TGAGGCCTGTTGGGGGGAATGGG - Intergenic
1108561621 13:51649578-51649600 TGGGGCCTATTGTGGGGTAGGGG - Intronic
1109081344 13:57905291-57905313 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
1109191074 13:59324996-59325018 TGGGGCCTACAGGAGGGCAGTGG + Intergenic
1109198629 13:59407010-59407032 TGGGGCCTACTTGAGGGCAGAGG - Intergenic
1109329235 13:60906878-60906900 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1109899913 13:68753912-68753934 TGGGGCCTGCTGGGGGGTGCGGG + Intergenic
1109946302 13:69436534-69436556 TGGGGCCTGTTGTGGGGTACGGG + Intergenic
1109968481 13:69734074-69734096 TGGGGCCTGGTGGGGGTAATTGG + Intronic
1110728518 13:78853292-78853314 TGGGGTCTACTGGGGTCTACTGG - Intergenic
1110825736 13:79969611-79969633 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
1111283940 13:86064003-86064025 TGGGGCCTAGTGGGAGGTAATGG - Intergenic
1111313680 13:86522728-86522750 TGGGGCCTACTGGAGGGTGAAGG + Intergenic
1111327522 13:86718885-86718907 TGGGGCCTACTGGGTGGTGTTGG + Intergenic
1111450853 13:88413377-88413399 TGAGGCCTACTGGAGGGCAGAGG + Intergenic
1111636604 13:90912809-90912831 TGGGGACTGCTAGGGGGAAGGGG - Intergenic
1111965401 13:94856807-94856829 TGGGGCCTACTTGGGGGTGAAGG - Intergenic
1112364604 13:98746031-98746053 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1113047364 13:106170293-106170315 TGGGGCTTTCTGGAGGGAACTGG - Intergenic
1113783752 13:112991083-112991105 TGGGGCCTGCAGGAGGGGACGGG + Intronic
1114694884 14:24617534-24617556 TGGGGCCTATTGGGGGGTGGGGG - Intergenic
1115062340 14:29208442-29208464 TGGGGCCTGTTGGGGGGTAGGGG - Intergenic
1116018832 14:39437417-39437439 TGGGGACTACTGGTGGGGAGGGG - Intergenic
1116163067 14:41294454-41294476 TGAGGCCTACTTGGGGGTAAAGG + Intergenic
1116239831 14:42325873-42325895 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1116673764 14:47878397-47878419 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1116805236 14:49488084-49488106 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1117851060 14:59970117-59970139 TGGGGCCTACTGGAGGGAGGGGG - Intronic
1118373967 14:65160948-65160970 TGGGGCCTATTGGAGGGTACAGG - Intergenic
1118536030 14:66765598-66765620 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1118877885 14:69799776-69799798 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1120291444 14:82576995-82577017 TGGGGCCTACTTGAGGGTAAAGG + Intergenic
1120483132 14:85077505-85077527 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1120576596 14:86188767-86188789 TGGGGCTTACTGGTGGGCAGAGG - Intergenic
1120663351 14:87276987-87277009 TGGGGCCTACTTGAGGGAGAAGG - Intergenic
1123670102 15:22647876-22647898 TGGGACCTACTGGGGGGCTGGGG + Intergenic
1124412799 15:29450939-29450961 TGGGGCCTACTTGAGAGAAGAGG + Intronic
1124526076 15:30454292-30454314 TGGGACCTACTGGGGGGTTGGGG + Intergenic
1124681561 15:31736048-31736070 TGGGGCCTACTGGAGGGCAGAGG + Intronic
1124772578 15:32553393-32553415 TGGGACCTACTGGGGGGTTGGGG - Intergenic
1125087080 15:35742705-35742727 TGGGACCTACTGGAGGGCAGAGG - Intergenic
1125443604 15:39729874-39729896 TGGGGCCTACTTGAGGGCAGAGG + Intronic
1125874735 15:43133914-43133936 TGCGGCCTCCTGGGGGGCGCGGG - Exonic
1126204560 15:46030419-46030441 TGGGGACTACTTGGGGGAGACGG - Intergenic
1127100817 15:55562981-55563003 TGGGGCCTGTCGGGGGGAGCGGG + Intronic
1127728499 15:61776015-61776037 TGGGGACTACTTGGGGGCAGGGG + Intergenic
1127793823 15:62421661-62421683 TGGGGCCTATTGGAGGGTAGGGG + Intronic
1128367014 15:67011619-67011641 TGGGGCCTAGGGAGGGGAAATGG - Intergenic
1128978130 15:72167959-72167981 TGGGGCCTGCGGTGGGGAAGGGG - Intronic
1129688055 15:77697498-77697520 TTGGGCCTACTGAGGGGAGTGGG - Intronic
1129932921 15:79427254-79427276 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1130069537 15:80634929-80634951 TGGGGCCTACTTGAGGGAGTAGG - Intergenic
1130119614 15:81036349-81036371 TGGGGCCTACTGGAGGGTGGAGG - Intronic
1130356981 15:83142512-83142534 TAGGGCCTACTGGAGGGTAAAGG + Intronic
1131648620 15:94374734-94374756 AGGGGCATCCTGGGAGGAACAGG - Intronic
1132362171 15:101225486-101225508 TGGGTCCTGGTGGGAGGAACTGG + Intronic
1132543924 16:524464-524486 TCGGGCCTCCTGGGGGGTGCAGG - Intergenic
1132804576 16:1769600-1769622 TGGGGGCTTCTGGGAGGGACAGG - Exonic
1134070431 16:11256629-11256651 TGTGGCCTCCTAGGGGGATCTGG - Intronic
1134433236 16:14231540-14231562 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1134765655 16:16755573-16755595 TGGGGCCTCCTGGGAGGTATTGG - Intergenic
1134980394 16:18603640-18603662 TGGGGCCTCCTGGGAGGTATTGG + Intergenic
1135187147 16:20324946-20324968 TGGGGCATGCTGGTGGGATCTGG - Intronic
1135575102 16:23579712-23579734 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1135658481 16:24272999-24273021 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1136171809 16:28494515-28494537 TGGGGGCTACTGTGGGCATCAGG + Intronic
1136179125 16:28538863-28538885 TGGGGGCTGCTGGGGGGCGCTGG + Exonic
1137495270 16:48964604-48964626 TGGTGGCAACTGGGGGGAACTGG + Intergenic
1138584564 16:57961484-57961506 TGGGCCATACTTGGGGGAACCGG - Intronic
1138882176 16:61030302-61030324 TGGGGCCTACAGGTGGGATGGGG - Intergenic
1138882502 16:61032568-61032590 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1139959450 16:70709377-70709399 TGGGGCCTTCTGGTGTGGACTGG + Intronic
1140775253 16:78243517-78243539 TGGGGCCTACTGGAGGGTAGAGG - Intronic
1142157956 16:88541197-88541219 AGCGGCCTCCTGGGGGGATCTGG - Intergenic
1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG + Intronic
1143121204 17:4608113-4608135 TGGGGCCTCCTGGGAAGAACAGG - Exonic
1144122075 17:12165078-12165100 TGGGGCCTAGTGGGTGGTATTGG - Intergenic
1144134417 17:12279616-12279638 TGGGGCCTACTTGAGGGTAGCGG - Intergenic
1144817943 17:18049605-18049627 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1148438710 17:47700820-47700842 TGGGGCCTCCAGGGGGGCACTGG + Intronic
1148942642 17:51228207-51228229 TGGGGCCTATTGGAGGGTAGAGG + Intronic
1150193614 17:63270820-63270842 TGGGGCCTACTGGTGGGAGGAGG - Intronic
1150876337 17:68975006-68975028 TGGGGCCTGTTGGGGGGATGGGG - Exonic
1151805580 17:76402927-76402949 TGGGGCTGCCTGGAGGGAACGGG + Intronic
1152113889 17:78372960-78372982 TGGGGCCTCCCGGCTGGAACAGG - Intergenic
1154447780 18:14449374-14449396 TGGGTGCTACTGGGGTGCACAGG - Intergenic
1155102267 18:22623288-22623310 TGGAGCCTACTGGGGGCACCGGG - Intergenic
1155801147 18:30105166-30105188 TGGGGCCTACCTGAGGGTACAGG - Intergenic
1156208885 18:34916891-34916913 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
1157158480 18:45290267-45290289 TGGGGACTACTAGTGGGAGCAGG - Intronic
1157679358 18:49591936-49591958 TGGGGCATATTGGTGGGAACTGG - Exonic
1157685171 18:49637556-49637578 TGGGGCCTGGTGGGAGGTACTGG + Intergenic
1158022855 18:52864686-52864708 TGGGGCCTGTTGGGGGGATTGGG - Intronic
1159031219 18:63234243-63234265 TGGGGCCTATTGGAGGGGGCAGG - Intronic
1159281447 18:66291224-66291246 TGGGGCCTGCTGGGGGGTGCGGG + Intergenic
1159548362 18:69869491-69869513 TGGAGCCTACTGGAGGGCAGAGG + Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162287163 19:9747435-9747457 TGGGGCCTGCTGGGGGGAGGGGG - Intergenic
1162308052 19:9887619-9887641 TGGGGGCAAGTAGGGGGAACTGG - Intronic
1162584366 19:11549955-11549977 GGGGGCCCATTGGGGGGAAGGGG + Exonic
1163420591 19:17211808-17211830 TGGGGCCTGCTGGGATGGACGGG - Intronic
1163524603 19:17812972-17812994 TGGGGGCTACAGGGGGTCACTGG - Exonic
1163585254 19:18160454-18160476 TGAGGCCTGGTGGGGGAAACAGG - Exonic
1163696386 19:18765606-18765628 TGTGGCCTCCTGGAAGGAACAGG - Intronic
1163770272 19:19186864-19186886 TGGGGCCTGCTGGGAGGAGCAGG - Intronic
1163843555 19:19626515-19626537 TGGGGCCCCCAGGGGGCAACAGG - Intronic
1164432804 19:28202603-28202625 TGGGGCCTAATGGAGGGTAGAGG + Intergenic
1164612616 19:29643083-29643105 TGGGGGGTGCAGGGGGGAACAGG + Intergenic
1164898542 19:31898387-31898409 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1166125742 19:40714595-40714617 GGGGGCCTACTTCGGGGGACCGG - Exonic
1166415865 19:42594689-42594711 TGGGGTCTCCTGGGGAGGACGGG - Intronic
1166531667 19:43546665-43546687 TGGGGGCTTCTGGGGTGAGCTGG + Exonic
1166930643 19:46299206-46299228 TGGGGCCAGCTGGGGCGATCTGG + Intronic
1167216531 19:48169625-48169647 TGGGCCCTACTGGAGGGAGATGG - Intronic
1167790073 19:51670291-51670313 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1167997384 19:53417284-53417306 TGGGGCCTATTGGAGGGCATAGG - Intronic
925707214 2:6698131-6698153 TGGGGGGAACTGGGGGGAACAGG - Intergenic
925899408 2:8497805-8497827 TGGGGACTACTAGAGGGGACAGG - Intergenic
927046622 2:19285622-19285644 TGGGACCTACTTGAGGGTACAGG + Intergenic
927076824 2:19586896-19586918 TGGGGCCTACTGGGTTGAGGGGG + Intergenic
927248001 2:20973531-20973553 TGGGCCCTGCTGGGGTGGACAGG + Intergenic
928346884 2:30507473-30507495 TGGGGCCTACTGAAGGGTAGAGG - Intronic
929319845 2:40529631-40529653 TGGGGCCTGTTGGGGGGTAGGGG + Intronic
929417760 2:41761085-41761107 TGGGGACAACTGGGTGAAACGGG - Intergenic
929754388 2:44752013-44752035 TGGGGCCTAGTGGGAGGTATTGG - Intronic
929975104 2:46626096-46626118 AGGGGACTACTGGAGGGAAGAGG - Intergenic
930710327 2:54544929-54544951 TGGGGCCTACTGGGGAGTGGGGG - Intronic
931524402 2:63136714-63136736 TGAGGCCTATTGGAGGGTACTGG - Intronic
931677028 2:64707631-64707653 TGGGGCCTACTTGAGGGAGCAGG + Intronic
932007380 2:67940286-67940308 TGAAGGCTACTGGGGGGATCTGG - Intergenic
932079763 2:68702502-68702524 TGGGGACTACTAGGAGGAGCAGG + Intronic
932340105 2:70958280-70958302 AGGGGCCTGCTGGAGGGAATGGG - Intronic
932809476 2:74812265-74812287 TGGGGCCTACTGGAGGGCAGAGG - Intergenic
933198052 2:79415108-79415130 TGGGGCCTAATGGGAGGTATTGG + Intronic
935637688 2:105262234-105262256 TGGGGCCTAGTGGGAGGTATTGG + Intergenic
936884197 2:117289627-117289649 TGGGGCCTAGTGGGAGGTATTGG - Intergenic
937239914 2:120453303-120453325 TGGGGCCTGCTGGGTGGACAGGG + Intergenic
938134494 2:128743677-128743699 TGGGGCCTATTGGAGGGTAGAGG - Intergenic
938558903 2:132452630-132452652 TGGGGCCTATTGGGGGGTGGGGG - Intronic
939242521 2:139579513-139579535 TGGGGCCTGCTGGGGGGTTCTGG + Intergenic
939424480 2:142016666-142016688 TGGGGCCTGTTGGGGGGTAGGGG + Intronic
939772190 2:146335213-146335235 TGGGGTCTACTAGGGGGAAAAGG - Intergenic
940081834 2:149811893-149811915 TGGGGTCTAGTGGGAGGTACTGG + Intergenic
940829450 2:158452246-158452268 TGGGGCTTCCTGTGGAGAACAGG + Intronic
941208965 2:162611163-162611185 TGGGGCCTGCTGGGTGGCATTGG + Intronic
941239956 2:163024993-163025015 TAGGGCCTACTGGAGGGCAGAGG + Intergenic
941240852 2:163035875-163035897 TGGGGCCTATTGGAGGGCAGAGG - Intergenic
941566006 2:167109024-167109046 TGGGGCCTACTTGAGGGTAGAGG - Intronic
942621782 2:177851903-177851925 TGGGGCCTACTGGAGGGTGGAGG - Intronic
942908555 2:181213071-181213093 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
943096180 2:183431976-183431998 TGGGGCCTGTTGGGGGGATAGGG + Intergenic
943158455 2:184215399-184215421 TGGGGCCTGTTGGTGGGAAGTGG - Intergenic
943512472 2:188842119-188842141 TGGGGCCTGTTGGGGGGTAGAGG + Intergenic
943834727 2:192504927-192504949 TGGGACCTACTGGGGCGCAGAGG - Intergenic
944439003 2:199723113-199723135 TGGGGCCTATTGGTGGGGGCAGG - Intergenic
944533463 2:200686697-200686719 TGGGGCCTATTGGAGGGTAGAGG + Intergenic
945139830 2:206673085-206673107 TGGGGCCTACTGGAGGGCAGAGG - Intronic
945630873 2:212274925-212274947 TGGGGCCTGCTGGTGGGTAGGGG - Intronic
947327025 2:228990846-228990868 TGGGGCCTACTTGAGGGAGGAGG + Intronic
948331283 2:237167954-237167976 TGGGGCCTACTGGAGGGCGGAGG - Intergenic
1168801923 20:648909-648931 TGGGTCCTCCTGGGGAGAAGAGG + Exonic
1168828858 20:833544-833566 TGGGGCCGGCTGGGAGGAGCGGG + Intergenic
1170014043 20:11760778-11760800 TGGGGCCTAGAGAGGTGAACAGG - Intergenic
1170540811 20:17385782-17385804 TGTGTCCTACTGTGGGCAACAGG + Intronic
1170766588 20:19294435-19294457 TGGGGCCTGTTGGGGAGAAGGGG - Intronic
1170823921 20:19777273-19777295 AGGGGCCTAGTGGGGTGAAGAGG - Intergenic
1173447708 20:43134957-43134979 TGGGTGCTACTGGCGTGAACAGG - Intronic
1173672659 20:44809589-44809611 TGGGGCAGACGGAGGGGAACCGG - Intronic
1173805656 20:45923447-45923469 TGGGGGCTGATGGTGGGAACAGG + Intergenic
1174068970 20:47886766-47886788 TGGTGTCTGCTGGGAGGAACTGG + Intergenic
1176368574 21:6048914-6048936 TGGGGCCTGGTGGGAGGAGCTGG + Intergenic
1176448427 21:6841291-6841313 TGGGTGCTACTGGGGTGCACAGG + Intergenic
1176826597 21:13706313-13706335 TGGGTGCTACTGGGGTGCACAGG + Intergenic
1177320762 21:19516860-19516882 TGGGGCCTACTTGAGGGGAGAGG + Intergenic
1177376263 21:20274223-20274245 TGGGGCCTATTGGAGGGTAGAGG - Intergenic
1178917356 21:36713994-36714016 TGGGAACTACTGTTGGGAACAGG + Intronic
1178935915 21:36861547-36861569 TGTGGCCTACTGGAGGGTAGAGG - Intronic
1179086215 21:38220184-38220206 TGGGGTCTACTTGAGGGCACAGG + Intronic
1179164147 21:38922498-38922520 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1179495415 21:41768324-41768346 GGGGGCCTCCTGGGGGGACCAGG + Intergenic
1179754945 21:43489628-43489650 TGGGGCCTGGTGGGAGGAGCTGG - Intergenic
1179908294 21:44435337-44435359 TGGTGCCTACTGGGGGGATGCGG + Intronic
1180874893 22:19170627-19170649 GGGGGCCTGCTGGCAGGAACAGG - Intergenic
1181467109 22:23116212-23116234 AGGGGCCTTCTGGGGGCCACTGG + Intronic
1183591320 22:38780838-38780860 TGGAGCCAACTGCAGGGAACAGG + Intronic
1183987284 22:41576519-41576541 TGGGGCCTCCTGGGTGGCAGGGG + Exonic
1184816253 22:46873672-46873694 TGAGGCCTACTGGAGGGCAGAGG - Intronic
949194226 3:1286350-1286372 TGGGGCCTACTGGGGGTTGGGGG - Intronic
950613280 3:14139511-14139533 TGGGGCCAACTCTGGGGCACTGG + Intronic
951217907 3:20041201-20041223 TGTGTCCCACTGGGAGGAACTGG + Intronic
951237429 3:20251917-20251939 TGGGGCCTAATGGGAGGTATTGG - Intergenic
951405931 3:22297235-22297257 TAGGTCCTATTGGGGGGATCTGG - Intronic
952565926 3:34657789-34657811 TGGGGCCTACTTGAGGGAGAAGG - Intergenic
952816968 3:37454047-37454069 TGGTGCCTAGTGTGGGGATCTGG - Intronic
953587656 3:44219195-44219217 TGGGGCCTACTTGAGGGTATAGG - Intergenic
954135247 3:48579396-48579418 TGGGTCCCCCTGGAGGGAACAGG + Exonic
954585172 3:51728398-51728420 TGGAGCCTACTGGGAGGTATTGG - Intergenic
955839243 3:63094563-63094585 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
956104545 3:65803702-65803724 TGGGGCCTACTGGAAGGTAGAGG - Intronic
959019912 3:101177686-101177708 TGGGGCCTACTGGAGGAAAGAGG - Intergenic
960125764 3:113996859-113996881 TGGGGCCTGCTGGGGGGTGGGGG + Intronic
960314505 3:116160064-116160086 TGGGGCCTACTCAGGGGTAGAGG + Intronic
960550948 3:118975855-118975877 TGGGGACTACTGGGGGGCAGGGG + Intronic
960730912 3:120725785-120725807 TGGGGCCTATTGTGGGGAGGAGG + Intronic
960733099 3:120747400-120747422 TGGGGCCTATTGTGGGGAGGAGG - Intronic
961061409 3:123832039-123832061 TGGGGCATTCTGGAGGGAGCTGG + Intronic
961125259 3:124411874-124411896 TGGGGCATCCTTGGGGGATCTGG - Intronic
961987231 3:131149147-131149169 TGGGGCCTACTTGAGGGTAGAGG - Intronic
963208845 3:142666104-142666126 TGGGGGCCACTGGGGAGAAGGGG + Intronic
963407345 3:144882938-144882960 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
963594433 3:147307503-147307525 TGGGGCCTGTTGGGGGGCAGGGG - Intergenic
964759570 3:160121918-160121940 TGGGGCCTATTGGGGGGTGGGGG + Intergenic
964893956 3:161571700-161571722 TGGGGCCTACTTGGGAGCAGAGG - Intergenic
965134024 3:164739315-164739337 TGGGGCCTAGTGGGAGGTATTGG - Intergenic
965457305 3:168918770-168918792 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
965930470 3:174036757-174036779 TGGGGTCTATTGGAGGGCACAGG - Intronic
968251206 3:197216449-197216471 TGGGGCAGTCTGGGGGAAACTGG + Intronic
968908738 4:3466178-3466200 TTGGGCTGGCTGGGGGGAACTGG - Intronic
969036498 4:4258053-4258075 TGGGGCCTACTGGAGGGCAGCGG + Intergenic
970137694 4:12943955-12943977 TGGGGCCTATTGGTGGGTAGAGG - Intergenic
970321138 4:14876766-14876788 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
970631605 4:17952893-17952915 TGGGGCCTACTTGAGGGAGGAGG - Intronic
970682624 4:18528106-18528128 TGGGGCCTATTGGAGGGTAGAGG - Intergenic
970911221 4:21278355-21278377 TGGGGCCTACTGGAGGGTGGAGG - Intronic
971882288 4:32392570-32392592 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
972300281 4:37779061-37779083 TGGGGCCTAGTGGGAGGTGCTGG + Intergenic
973575325 4:52282159-52282181 TGGGGCCTACTGGAGGGTATAGG + Intergenic
974513927 4:62883106-62883128 TGGGGTCTACTTGGGGGTGCAGG - Intergenic
974780276 4:66544940-66544962 TGGGGCCTACTGGAGGGTGCAGG + Intergenic
974914613 4:68164147-68164169 TGGGGCCTACTTGAGGGTGCAGG + Intergenic
975052167 4:69879447-69879469 TGGGGCCTATTGGAGGGCAGAGG - Intergenic
975551435 4:75616942-75616964 TGGGGCCTACCGGAGGGCAAAGG + Intronic
975950205 4:79761415-79761437 TGGGGCCTGCTGGGGGGTGGGGG - Intergenic
976136672 4:81945098-81945120 TGGGGGCTACTGTGGGGAGGTGG + Intronic
976223958 4:82780797-82780819 TGGGGCCTCCTGGGGTGGCCAGG - Intronic
976315813 4:83657585-83657607 TGGGGCCTATTGTTGGGTACAGG + Intergenic
977154207 4:93552786-93552808 TGGGGCCTATTGGGGGGTGGGGG - Intronic
978053195 4:104229131-104229153 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
978337028 4:107680503-107680525 TGTGGCATACTGGGAGGCACAGG - Intronic
978707413 4:111730780-111730802 TGGGGCCTATTGTGGGGCAGGGG - Intergenic
979016432 4:115440655-115440677 TGGGGACTACTGGGGGGGTGAGG - Intergenic
979824836 4:125220407-125220429 TGGGGCCTACTGGAGGGCAGAGG + Intergenic
980188564 4:129494260-129494282 TGGGGCCTAATGGTGGTTACAGG + Intergenic
980880623 4:138706743-138706765 TCGGGACTACTGCAGGGAACTGG + Intergenic
980908030 4:138968077-138968099 TGGGGACTACTGGAGGGAGGAGG + Intergenic
980948802 4:139350498-139350520 TGGGGTCCACTTGTGGGAACAGG + Intronic
982411078 4:155078060-155078082 TGGGGCCTAATGGGGGGTGTTGG + Intergenic
982600049 4:157437678-157437700 TGGGGCCTACTGGAGGGGAGAGG - Intergenic
982884278 4:160758675-160758697 TGGGGACTACTAGAGGGAAGTGG - Intergenic
983466879 4:168105270-168105292 TGGGGCATACTGGAGGGAGGTGG - Intronic
983584298 4:169339009-169339031 TGGGGCCTATTGGAGGGTAGAGG - Intergenic
983688387 4:170437638-170437660 TGGGGCCTATTGGGGGGTGGGGG + Intergenic
983696908 4:170543602-170543624 TGGGGTCTGCTGGGGGGTAGAGG + Intergenic
986356141 5:6928769-6928791 TGGGGCCTACTTGGGGAAAAGGG - Intergenic
986771823 5:10980882-10980904 TGGGGCCTGCTGGGGGTCAGGGG + Intronic
986971375 5:13340981-13341003 TGGGGCCTATTGTGGGGTTCAGG - Intergenic
987010380 5:13756859-13756881 TGGGGCCTACTGGAGGGTGGAGG - Intronic
988010564 5:25476503-25476525 TGGGGCCTGCTGTGGGGTAGGGG + Intergenic
988163123 5:27547159-27547181 TGGGGCCTACCGGAGGGTAGAGG - Intergenic
988201871 5:28078255-28078277 TGGGGCCTACTTGAGGGCAGAGG - Intergenic
988634145 5:32963449-32963471 TGGGGCCTAGTGGGAGGCATTGG - Intergenic
988675104 5:33425058-33425080 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
989459258 5:41678361-41678383 TGGGGGATGCTGGGGGGAAGAGG + Intergenic
989526488 5:42459500-42459522 TGGGGCCTACTTGTGGGTAGAGG + Intronic
989548642 5:42705558-42705580 TGGGGCCTACTGGAGGGTAGTGG - Intronic
989749893 5:44880780-44880802 TGTGTCCTAGTGGGGGGAAAAGG + Intergenic
990215005 5:53521160-53521182 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
990291500 5:54356441-54356463 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
991238277 5:64424870-64424892 TGGGGCCTATTGGAGGGTAGAGG + Intergenic
992015379 5:72569979-72570001 AGGGGCCTGCTGGGGGACACGGG - Intergenic
992023683 5:72650293-72650315 TGGGGCCTGCTGGGGGGTGAGGG - Intergenic
992056304 5:72994942-72994964 TGGGGCCTACTGGAGGAGAGAGG + Intronic
992315896 5:75554660-75554682 TGGGGCCTACTGGAGGGTGGAGG - Intronic
992520152 5:77542261-77542283 GGGGGCCTACTGGAGGGTAAAGG + Intronic
992528303 5:77631913-77631935 TGGGGGCGACTTGAGGGAACTGG - Intronic
993673145 5:90786238-90786260 TGGGGCCTATTGGGGGGTGGGGG + Intronic
993697093 5:91074330-91074352 TGGGGCCTACTTGAGGGTAGAGG - Intronic
994388841 5:99165389-99165411 TGGGGCCTGCTGGGGGGTGGGGG - Intergenic
994645706 5:102466182-102466204 TGTGGCCTACTGGAGGGCAGAGG - Intronic
995293179 5:110484149-110484171 TGGAGATTACTGGGGGGAAGGGG + Intronic
995475589 5:112544933-112544955 CGGGGCCTGCTGGGGGGTAGGGG + Intergenic
995578449 5:113568527-113568549 TGGGGCCTACTGGGGGTGTGTGG - Intronic
995992898 5:118264118-118264140 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
996006173 5:118423070-118423092 CAGGGCCTACTGGGGGGTAGGGG + Intergenic
996106888 5:119515849-119515871 TGGGGCCTACTGGAGGGTAGAGG + Intronic
996380439 5:122857563-122857585 TGGGGCCTACTGGAGGGTGAAGG - Intronic
997530647 5:134579347-134579369 TGAGGCCTTGTGGGGGGACCAGG - Exonic
997745377 5:136295517-136295539 TGGGGACTACTGGGGGCACTGGG - Intronic
999150354 5:149422539-149422561 TGGGGCCTGCAGGGGTGAACAGG - Intergenic
1000774797 5:165406321-165406343 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1000786964 5:165556749-165556771 TGGGGCCTATTGGAGGGTAGCGG + Intergenic
1001603387 5:172943609-172943631 TGGGGCCCACTGCAGGGACCGGG - Intronic
1002160209 5:177310532-177310554 TGGGCCCTCCTGTGGGGAAGAGG + Exonic
1002821204 6:726661-726683 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1004182041 6:13389601-13389623 TGGGGCCTGTTGGGGGGTGCGGG + Intronic
1004793700 6:19057563-19057585 TAGGGCCTACTCGGGGGTAGAGG + Intergenic
1005244908 6:23872636-23872658 TGGGGCCTACTTGAGGGTAGAGG + Intergenic
1005283236 6:24297297-24297319 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1006788813 6:36685621-36685643 TGGGGCCGACTGCTGAGAACAGG - Intronic
1007215374 6:40233286-40233308 TGGAGACTACTGTGGGAAACTGG - Intergenic
1008127377 6:47684148-47684170 TGAGGCCCAGTGGGGGGCACTGG + Intronic
1009423088 6:63485189-63485211 TGGGGCCTATTGGAGGGTAGAGG - Intergenic
1010252605 6:73723729-73723751 TGGGGCCTACTGGAGGGTAGAGG + Intronic
1010741783 6:79514848-79514870 TGGGGCCTATTGGAGGGTGCAGG + Intronic
1011513927 6:88131688-88131710 TGGGCCCTACTGGGGGCTCCTGG + Intergenic
1011746626 6:90413179-90413201 TGGGGCATTCTTGGTGGAACAGG - Intergenic
1011979340 6:93352923-93352945 TGGGGCCTACTGTGGGGTGGAGG + Intronic
1012435812 6:99214313-99214335 TGGGGACTACTAGAGGGAAGAGG + Intergenic
1012736303 6:102949439-102949461 TGGGGCCTAGTGGGAGGCATTGG - Intergenic
1013376893 6:109526120-109526142 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1014846324 6:126281908-126281930 TGGGGCCTACTGGAGGGTGGGGG - Intergenic
1015043385 6:128748568-128748590 TGGGGCCTGCTTGGGGGTAAAGG + Intergenic
1015686375 6:135867586-135867608 TGGGGCCTACTGGACGGTAGAGG - Intronic
1016768246 6:147819314-147819336 TGGGGCCTACTTGGGGGTGGAGG + Intergenic
1018211229 6:161484012-161484034 TGGGGCCTGCTGGGGGGTTGTGG + Intronic
1019492273 7:1321118-1321140 TGGGGCCGAGTGGGGGGACCTGG + Intergenic
1019517189 7:1445239-1445261 CTGGGCCTTCTGTGGGGAACAGG + Exonic
1020107626 7:5429444-5429466 TGGGGCCTAGCGGGGGAAGCTGG - Intergenic
1021572489 7:22080605-22080627 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1022515388 7:30971949-30971971 TGGAGCCTCCTGGGGGTAATGGG - Exonic
1022764417 7:33394388-33394410 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1023228357 7:37996623-37996645 TGGGGCCTACTGGGGGGTGGGGG - Intronic
1023325264 7:39048365-39048387 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1023875703 7:44285162-44285184 CGGGGCCTCCTGGTGGGCACCGG - Intronic
1024440969 7:49417058-49417080 TGGGGCCTAGTGGGAGGTATTGG - Intergenic
1024602558 7:50996721-50996743 TGGGGACTACTGGGAGGGAGGGG - Intergenic
1024660275 7:51486516-51486538 CGGGGCCTACTGGGGGGTGGGGG - Intergenic
1024969838 7:55058674-55058696 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1026149777 7:67778054-67778076 TGGGGCCTATTGGGGGGTAGGGG - Intergenic
1026576233 7:71573831-71573853 TGGGGCCTACTTGAGGGCAGAGG - Intronic
1026590758 7:71693634-71693656 TGGGGCCTATTGGAGGGTAGGGG + Intronic
1026640474 7:72120095-72120117 TGGGGACTACTGGGGGTCAAGGG - Intronic
1027481607 7:78704990-78705012 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1027711049 7:81601761-81601783 TGGGGCCTAGTGGGAGGTACTGG + Intergenic
1027739209 7:81978568-81978590 TGGGGCCTGTTGGGGGGCAAGGG + Intronic
1028120295 7:87049868-87049890 TGGGGCCTAATGGGAGGTATTGG + Intronic
1028290545 7:89059561-89059583 TGGGGCCTGGTGGGAGGTACTGG - Intronic
1028320189 7:89450170-89450192 TGGGGCCTGTTGTGGGGAGCAGG + Intergenic
1028513006 7:91645549-91645571 TGGGGCCTGCTGGGGGGTAGGGG - Intergenic
1028683608 7:93567703-93567725 TGGGGCCTGTTGGGGGGCAGGGG - Intronic
1029029081 7:97449815-97449837 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1029955656 7:104636534-104636556 TGGGGCCTACTTGAGGGAGAAGG - Intronic
1030718946 7:112846351-112846373 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1031039158 7:116820522-116820544 TGGGGCCTACTGGAAGGTAAAGG - Intronic
1032625009 7:133582130-133582152 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1034112445 7:148550718-148550740 TGGGGACTACTGGAGGGGAATGG - Intergenic
1034389631 7:150775239-150775261 TGGGGCCTACTTGAGGGAGAAGG + Intergenic
1034836114 7:154352663-154352685 TGGGGCCTATTGGGGGGTGTGGG + Intronic
1035147052 7:156829348-156829370 TGGGGCCTCATGGGAGGTACTGG + Intronic
1035241328 7:157531642-157531664 TGGGGCCTACTTGAGGGTGCAGG - Intergenic
1035908647 8:3541364-3541386 TGGGGCCTGTTGAGGGGAGCTGG + Intronic
1037217186 8:16470239-16470261 TGGGGCCTATTGGGGGGTGGAGG - Intronic
1037311362 8:17560110-17560132 TGGTGACTACTGGGGGAAATTGG + Intronic
1037386104 8:18343843-18343865 TGGGGCCTAGTGGGAAGCACTGG + Intergenic
1038677762 8:29638843-29638865 TGGGGCCTATTGGGGGGTCGGGG + Intergenic
1038852227 8:31290762-31290784 TGGGGCCTGTTGGGGGAAAGGGG - Intergenic
1038998963 8:32958362-32958384 TGGGGACTACTAGAGGGAAAAGG - Intergenic
1040287769 8:46109211-46109233 TGGGGCCTTCTGGATGGAAGAGG + Intergenic
1040904870 8:52457658-52457680 TGGGGCCTAATGGGAGGTATTGG + Intronic
1041172395 8:55157677-55157699 TGGGGCCTACTTGAGGGTGCAGG - Intronic
1041895003 8:62914331-62914353 TGGGGCCTACTTGAGGGTAGAGG + Intronic
1041955763 8:63556756-63556778 TGGGTCCTCCTGAGGGGAAGCGG - Intergenic
1042197619 8:66245984-66246006 TGGGGCCTACTTGAGGGAGAAGG + Intergenic
1042586155 8:70340917-70340939 TGGGGCCTGTTGGGGGTAGCAGG + Intronic
1042713639 8:71747072-71747094 TGGGGCCTATTGGAGGGTAGAGG + Intergenic
1043529850 8:81137300-81137322 TGTGGCCTGCTGGTGGGGACGGG + Intergenic
1044053392 8:87538397-87538419 TGGGGCCTGCTGGGGGGTGGGGG - Intronic
1045618208 8:103942147-103942169 TGGGGCCTACCGGAGGGTAGAGG - Intronic
1045718829 8:105081565-105081587 TGAGGCCTACTTGAGGGAAGAGG + Intronic
1046715186 8:117559410-117559432 TGGGGCCTATTGGGGGGTGGGGG - Intergenic
1046733174 8:117747903-117747925 TGGGGCATACTGGGGGGAGTGGG + Intergenic
1046851915 8:118984320-118984342 TGAGGCCTACTTGAGGGTACAGG + Intergenic
1047243937 8:123121454-123121476 TGGGGCCTAGTGGGAGGTATTGG + Intronic
1047277976 8:123420069-123420091 TGGGGCCTACTTGAGGGTAGAGG - Intronic
1047769628 8:128020463-128020485 TGGGGCCCACTTGTAGGAACTGG + Intergenic
1048031764 8:130639802-130639824 TGGGGCCCACTGGGGTGGCCTGG + Intergenic
1048535667 8:135291872-135291894 TGGAGTTTACTGGGGAGAACCGG - Intergenic
1048716097 8:137272022-137272044 TGGGGCCTGCTTGGGGGCAGAGG + Intergenic
1049386832 8:142347106-142347128 TGGGCCCTGGTGGGGGGAAGAGG + Intronic
1049436517 8:142588588-142588610 TGGGGCCTTCTGGGAGGTATTGG + Intergenic
1049628440 8:143637209-143637231 AGGGGCCTACTGGGCGCCACAGG - Intronic
1049636736 8:143693003-143693025 TGGGGCCTGCTGGCGTGGACAGG + Intronic
1049689120 8:143951067-143951089 TGGGGCCTGGTGGGGGGAAAGGG - Intronic
1049725412 8:144143405-144143427 AGGGGCCTGCTGGGGGGCACTGG + Intergenic
1050912033 9:11083305-11083327 TGGGGCCTACTGAGAGGTATTGG - Intergenic
1051115702 9:13691983-13692005 TGGGGCCTATTGGAGGGAGGAGG - Intergenic
1051301852 9:15660475-15660497 TGGGGACTACTAGAGGGAAAAGG - Intronic
1052516988 9:29494605-29494627 TGGGGCCTATTGGGTGGTAGGGG + Intergenic
1053494727 9:38541823-38541845 AGGGGCCTACAGGGAGAAACAGG + Intronic
1053570265 9:39297112-39297134 TGGGGCCTACTTGAGGGTAAAGG + Intergenic
1054091887 9:60856122-60856144 TGGGGCCTACTTGAGGGTAAAGG + Intergenic
1054113301 9:61131712-61131734 TGGGGCCTACTTGAGGGTAAAGG + Intergenic
1054126884 9:61321894-61321916 TGGGGCCTACTTGAGGGTAAAGG - Intergenic
1054594399 9:67050457-67050479 TGGGGCCTACTTGAGGGTAAAGG - Intergenic
1057980351 9:99654889-99654911 TGGGGCCTACTAGAGGGTGCAGG + Intergenic
1058923052 9:109636249-109636271 TGGGGCCTAGTGGGAGGTATTGG + Intergenic
1059160145 9:112026378-112026400 TGGGGCCTGTTGGGGGGATGGGG - Intergenic
1060530887 9:124346501-124346523 TGGCCCCTCCGGGGGGGAACCGG + Intronic
1060732629 9:126048085-126048107 TGGAGGCCACTGGGAGGAACAGG - Intergenic
1060929456 9:127479692-127479714 TGTAGCCTACTGGGAGGAGCTGG + Intronic
1061623442 9:131826335-131826357 TGAGGTCTGCTGGGGGGATCTGG - Intergenic
1062057474 9:134475986-134476008 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057479 9:134476006-134476028 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057492 9:134476066-134476088 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057497 9:134476086-134476108 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057505 9:134476126-134476148 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057510 9:134476146-134476168 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057518 9:134476186-134476208 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057527 9:134476226-134476248 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057540 9:134476286-134476308 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057545 9:134476306-134476328 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057550 9:134476326-134476348 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057559 9:134476366-134476388 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062057573 9:134476446-134476468 TGGGGCCTAGAGTGAGGAACTGG - Intergenic
1062250036 9:135589264-135589286 TGGGGCCTCCAAGGCGGAACAGG - Intergenic
1203761310 EBV:13869-13891 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203762239 EBV:16941-16963 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203763168 EBV:20013-20035 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203764097 EBV:23085-23107 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765026 EBV:26157-26179 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203765955 EBV:29229-29251 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203766884 EBV:32301-32323 TGGGGGCTTCTGGGGGGACCGGG - Intergenic
1203520764 Un_GL000213v1:43227-43249 TGGGTGCTACTGGGGTGCACAGG - Intergenic
1185920036 X:4081295-4081317 TGGGGCCTACTGGAGGGTGGGGG - Intergenic
1186135962 X:6521119-6521141 TGGGGCCTTTTGGGGGGTAGGGG - Intergenic
1187136690 X:16554553-16554575 TGGGGCCTACTGGAGGGTGGAGG + Intergenic
1187605719 X:20880554-20880576 TGGGGCCTATTGGGGGAGAGTGG + Intergenic
1187696247 X:21924047-21924069 TGGGGCCTAGGGAGAGGAACAGG + Intergenic
1188099694 X:26069311-26069333 TGGGGTCTGCTGGGGAGGACAGG - Intergenic
1188806433 X:34596293-34596315 TGGGGCCTACTTGAGGGTAGGGG - Intergenic
1188859264 X:35237751-35237773 TGGGGTCTACTTGAGGGAAGAGG + Intergenic
1188950715 X:36370253-36370275 TGGGGCCTGCTGGGGGGTGGGGG - Intronic
1190230005 X:48574767-48574789 TGAGGCCTACCGGGAGGGACTGG + Intronic
1190358639 X:49628452-49628474 TGGGGCCTGTTGGGGGGTAGGGG - Intergenic
1190600139 X:52083382-52083404 TGGGGCCTACTGGAGGGCAGAGG - Intergenic
1190603537 X:52117095-52117117 CGGGGCCTACTGGGGGGTGGAGG + Intergenic
1190999234 X:55642528-55642550 TGGGGCCTATTGGAGGGTAGAGG + Intergenic
1191065945 X:56348029-56348051 TGGGGCCTGTTGGGGGGAGGGGG - Intergenic
1191721584 X:64233662-64233684 TGGGGCCTGCTGGGAGGTAGGGG + Intergenic
1192415075 X:70972540-70972562 TGGGGCCTACTAGAGGGTAGAGG + Intergenic
1192418188 X:71003486-71003508 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1192609647 X:72554703-72554725 TGGGGCCTGCTGTGGGGGACGGG - Intronic
1193847491 X:86492606-86492628 TGGGGACTACTAGAGGGAAGAGG - Intronic
1193859879 X:86652101-86652123 TGGGGCCTACTTGAGGGAGAAGG - Intronic
1194287332 X:92026034-92026056 TGGGGCCTACTGGAGGGTGGAGG + Intronic
1194347102 X:92779320-92779342 TGGGGCCTACTGGAGGGTTGAGG + Intergenic
1194572476 X:95569893-95569915 TGGGGCCTGCCGGGGAGAGCGGG - Intergenic
1194786674 X:98093396-98093418 TGGGGCCTGTTGGGGGGTAGGGG + Intergenic
1194797137 X:98225651-98225673 GGGGGCCTTCTGGGGGTAGCAGG + Intergenic
1195171141 X:102269702-102269724 TGGGGCCTGGTCGGGGGCACCGG - Intergenic
1195187719 X:102417397-102417419 TGGGGCCTGGTCGGGGGCACCGG + Intronic
1195496445 X:105540513-105540535 TGGGGACTACTAGAGGGAAGAGG + Intronic
1195735372 X:108007476-108007498 TGGGGACTACTGGAGGGGAAAGG + Intergenic
1196132558 X:112172994-112173016 TGGGGCCTGTTGGGGGGGTCGGG + Intergenic
1196343555 X:114625331-114625353 TGGGGCCTAATGGGAGGAGTTGG + Intronic
1196668019 X:118336551-118336573 TGGGGCCTATTGGAGGGAGAAGG + Intergenic
1196941295 X:120778680-120778702 TGGGGTTTGTTGGGGGGAACAGG + Intergenic
1197035826 X:121871415-121871437 TCAGGCCCACTGGGTGGAACAGG + Intergenic
1197256007 X:124263998-124264020 TGGGGACTACTGGAGGGGAGAGG - Intronic
1197422217 X:126252182-126252204 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1197926154 X:131648529-131648551 TGGGGCCTACTTGAGGGAGGAGG - Intergenic
1198420052 X:136462361-136462383 TGGGGCCTACTGAAGGGTAGAGG - Intergenic
1198670128 X:139070975-139070997 TGAGGCCTACTGGGGGGTGGAGG + Intronic
1198895190 X:141446305-141446327 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1199469145 X:148174538-148174560 TGGGGCCTACTTGAGGGTAGAGG - Intergenic
1199718019 X:150520388-150520410 TGGGGCCTACTTGAGGGAGGAGG + Intergenic
1199791383 X:151158451-151158473 TGGGGCCTACTGGAGGGTGGAGG - Intergenic
1200060321 X:153481045-153481067 TGGGGCCTGCTGGGGCTGACAGG + Intronic
1200655428 Y:5895958-5895980 TGGGGCCTACTGGAGGGTTGAGG + Intergenic