ID: 1030837192

View in Genome Browser
Species Human (GRCh38)
Location 7:114303568-114303590
Sequence AGAGATTAACTAGGAAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030837192 Original CRISPR AGAGATTAACTAGGAAACAA AGG (reversed) Intronic
904091392 1:27947345-27947367 AGAGATTTCCCAGGAAAAAAAGG - Intronic
904921888 1:34014383-34014405 AGAGATAAAGTTGGAGACAAGGG - Intronic
905501254 1:38439904-38439926 AGAAACTAACTAGAAGACAATGG - Intergenic
907542747 1:55231017-55231039 AAAGATTAACTAGAAAATGATGG - Intergenic
907618949 1:55955890-55955912 TGAGATAATCAAGGAAACAAGGG + Intergenic
908964762 1:69746709-69746731 AGAGATTGACAAGAAAACAATGG + Intronic
909718551 1:78739615-78739637 AGAGATTTAGGAGGAAAAAATGG + Intergenic
910270330 1:85387150-85387172 AGAGATTAACATGGATAAAAGGG - Intronic
910693816 1:89991559-89991581 AGAGATTAATTAGGAAGCTGAGG + Intergenic
911506937 1:98764797-98764819 AAAGATTTAATAGGTAACAAGGG - Intergenic
911722436 1:101205960-101205982 TGAGATTAAAGAGCAAACAATGG - Intergenic
912385071 1:109267424-109267446 GGACAGTAACTAGCAAACAAGGG - Intronic
917355341 1:174121245-174121267 AGAGATCAATTAGGACACTATGG + Intergenic
917675493 1:177315223-177315245 AGAGATGTACCAAGAAACAAAGG + Intergenic
919209361 1:194458539-194458561 AGAGATAGACCAGGAAAAAAAGG - Intergenic
920384172 1:205556314-205556336 AAAGATTAATTAGGAAAAAGTGG + Intergenic
921064382 1:211612301-211612323 AGATATTAACTAGGAAGCTCAGG + Intergenic
921673697 1:217953762-217953784 ACAGTTTAAGTATGAAACAAAGG + Intergenic
921726870 1:218533893-218533915 AGAGATTAATTAGGAGGCTATGG + Intergenic
921955469 1:220979195-220979217 AAAAATGAACTAGGAAACAGTGG - Intergenic
922088037 1:222369660-222369682 AGAGATTACCTCTGAAAGAAAGG + Intergenic
922109345 1:222542328-222542350 AGAGTTATACCAGGAAACAAGGG - Intronic
922747788 1:228055575-228055597 AGAAAATAAAGAGGAAACAATGG + Intronic
923656662 1:235922968-235922990 AGAGATAACCCAGGAGACAAGGG + Intergenic
924646058 1:245878219-245878241 ACAGATTAAACAGGAAACAATGG + Intronic
1062900358 10:1140274-1140296 CCAGATTAATCAGGAAACAAAGG - Intergenic
1062965616 10:1605411-1605433 AGAGATTGGCAAGGAAAGAAGGG - Intronic
1063328388 10:5128884-5128906 AGAAAGTAAATAGGAAACAATGG + Intronic
1063431020 10:5988259-5988281 AGAGATGAACCAAAAAACAAAGG - Intergenic
1064615110 10:17145414-17145436 AGAGATTAACTAGTAGACAGAGG + Intronic
1065007560 10:21393876-21393898 AGAGTTTAACTTTGAAACTAAGG + Intergenic
1066109103 10:32180739-32180761 ACAGACAAACTAGGAAAGAAGGG - Intergenic
1066469706 10:35686842-35686864 TGTTATTCACTAGGAAACAAGGG - Intergenic
1068526726 10:58138681-58138703 ATAGCTTAACTTTGAAACAAAGG - Intergenic
1071181010 10:82983753-82983775 AGACATTAAGTAGGATATAAAGG + Intronic
1071477720 10:86039088-86039110 AGTGGTTAGCTAGGAGACAATGG - Intronic
1071604861 10:86978801-86978823 AAGGATAAACTAGGAAATAAAGG + Intronic
1072533913 10:96345238-96345260 AAAGATTAAATAAGAAATAAAGG - Exonic
1073299095 10:102459965-102459987 AGACATTAAATGAGAAACAAGGG - Intergenic
1073828417 10:107354087-107354109 AGAGATTAAAGAGAATACAAAGG - Intergenic
1073919923 10:108446798-108446820 AGAAATAAACTAGGCAAAAATGG - Intergenic
1074035300 10:109732684-109732706 AGAGATGAAATAGGAAACTCTGG + Intergenic
1075550310 10:123388070-123388092 AGAGGTTTAGTAGGAAAAAATGG + Intergenic
1077641713 11:3887410-3887432 AGAGGTGAACCTGGAAACAATGG + Intronic
1077759675 11:5079322-5079344 AGAGATGAAGAAAGAAACAAAGG + Intergenic
1079717207 11:23763552-23763574 AAAAATTAACTAGGAAAAATAGG - Intergenic
1080978809 11:37376047-37376069 ACAGATTAACTTGGAGATAATGG + Intergenic
1081002948 11:37696726-37696748 AGACATTAGTTAGGAAATAAGGG - Intergenic
1081415111 11:42805293-42805315 TGATATTAATTAGGAAACTAAGG + Intergenic
1085505737 11:77057816-77057838 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1086333257 11:85775173-85775195 AGAGAATAATTAGGAAAATAGGG + Intronic
1086620570 11:88883192-88883214 AGTGACTAACTGGGAGACAATGG + Intronic
1089004507 11:115079727-115079749 ATAGATTAACAAGAAAACAGAGG - Intergenic
1089780658 11:120871114-120871136 TGAGATTAACTGGGAGGCAAGGG + Intronic
1089870277 11:121666433-121666455 AAAGATTAAATAAGATACAATGG - Intergenic
1091422149 12:351032-351054 AAAGATGAACTAGGAAATCAAGG + Intronic
1092183411 12:6461614-6461636 AGTGTTTAAGTATGAAACAAAGG + Intronic
1092719149 12:11423732-11423754 AGAGATTCACTTGGAAAGGATGG - Intronic
1093546538 12:20355296-20355318 AGAGATTAATTATCCAACAAAGG + Intergenic
1093613038 12:21185828-21185850 CTAGATTAACAAGGAAAAAAAGG + Intronic
1094303130 12:28988529-28988551 AGAGATTAATTAGGAAGTGATGG - Intergenic
1095095143 12:38143303-38143325 GGTGATTCCCTAGGAAACAAGGG - Intergenic
1095215483 12:39542511-39542533 AGAGATTAGTTAGAAAGCAATGG + Intergenic
1096172180 12:49480544-49480566 TGAGATACACTAGGATACAACGG - Intronic
1097640761 12:62178411-62178433 AGACATAAACTAGGAAACAAAGG + Intronic
1097838877 12:64301707-64301729 ACAGATGAACTGGGAAAGAAGGG - Intronic
1098025466 12:66196177-66196199 AGAGAGTCAGCAGGAAACAAAGG - Intronic
1098129753 12:67337437-67337459 AGAAATTAACAAAGAAACATTGG - Intergenic
1098257299 12:68630059-68630081 TGAGATCAACTAGGACTCAAAGG - Intronic
1099061946 12:77922401-77922423 AGAGAATAACTAAAAAATAAAGG - Intronic
1100167924 12:91939340-91939362 AGAGTTTAATTAGGAGATAAAGG - Intergenic
1100710164 12:97247339-97247361 AGAGCTAAACAAAGAAACAAAGG + Intergenic
1101632523 12:106509369-106509391 AGACAGCAACTCGGAAACAAAGG - Intronic
1104244644 12:127026386-127026408 AGAGCTTTCCTAAGAAACAAGGG + Intergenic
1104620707 12:130310678-130310700 AGAGATTAACTATAAAATATAGG + Intergenic
1105415834 13:20210698-20210720 AGAGATTAACTGGAAAACTAAGG + Intergenic
1105713763 13:23040083-23040105 AAAGATTAACTAGGAAGTCATGG - Intergenic
1105994977 13:25662258-25662280 AGAGGTTAACCAGGAGACAAAGG + Intronic
1106006394 13:25774095-25774117 AGGGATTAATTATTAAACAAAGG - Intronic
1106198805 13:27518787-27518809 ACAGATTAATTTGGAAACTATGG - Intergenic
1106556670 13:30815405-30815427 AGAGATCATTTAGGAAAGAAAGG + Intergenic
1107129664 13:36881613-36881635 AGAGATAAACTATGACAAAAGGG + Intronic
1107579548 13:41767942-41767964 AAATATTCACTAAGAAACAATGG + Intronic
1108347095 13:49557002-49557024 AGAAATGGACTAGGAAACAGTGG + Intronic
1110039803 13:70739165-70739187 TGAAATTAACAAGGAAAGAAAGG - Intergenic
1110221017 13:73073534-73073556 AGAGTTTATGTAAGAAACAAGGG - Intronic
1110233324 13:73189926-73189948 GGAGATGGGCTAGGAAACAATGG - Intergenic
1110875917 13:80510342-80510364 AGAGATTAACTATAGGACAAAGG + Intergenic
1112456679 13:99569454-99569476 GGAGATTAACAAGGCTACAAGGG + Intergenic
1113060280 13:106315030-106315052 AGACACTAACTTGGAAACATAGG + Intergenic
1114372116 14:22101058-22101080 ATAGAATACCTTGGAAACAAAGG + Intergenic
1114881671 14:26793900-26793922 AGAGTTAAACTAGGAAGCTATGG + Intergenic
1114906156 14:27129327-27129349 AGAGATTACCTAGAATACTAAGG - Intergenic
1116389663 14:44377230-44377252 AGAGATTTAGGAGGAAAAAATGG - Intergenic
1116516309 14:45810797-45810819 AGATAGTAACTAAGAAAGAAAGG + Intergenic
1116769172 14:49107271-49107293 ATAGATTAACTAGGATTCACAGG - Intergenic
1118091553 14:62485999-62486021 AGATATTATCTCGGAAAAAATGG - Intergenic
1118160586 14:63285927-63285949 AGAGATTAAAAAAGAAAAAATGG - Intronic
1118618103 14:67589287-67589309 AGAAACTAACTTAGAAACAAAGG + Exonic
1119928690 14:78523150-78523172 AGAGATAATCTGGAAAACAAGGG - Intronic
1119928968 14:78525737-78525759 AGAGATTAACTGGCAAAAAATGG + Intronic
1120401803 14:84041734-84041756 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1120571696 14:86126003-86126025 AGAGCTAAAGAAGGAAACAATGG - Intergenic
1122556644 14:102584124-102584146 AGAGATCATCTTTGAAACAAGGG - Intergenic
1124234448 15:27975857-27975879 ATAGATTAATTTGGAAAGAATGG + Intronic
1124834172 15:33179693-33179715 AGAGATTAACTAGAAAATCATGG + Intronic
1126693729 15:51308394-51308416 AGAAACTAACTATGAAACAAAGG - Intronic
1128563507 15:68683808-68683830 AGGGATGAACCAGGAACCAAAGG + Intronic
1129932684 15:79425537-79425559 AGAGATAAAGGAGGAAACAGTGG - Intronic
1130633394 15:85592959-85592981 AGAGATTAACCATTACACAAAGG - Intronic
1131210094 15:90487607-90487629 AGAGCTTATCTACCAAACAAAGG - Intronic
1133438048 16:5796823-5796845 AGAGGTTAACCTGGAAACAAGGG - Intergenic
1135200796 16:20436286-20436308 AGACTTCAAGTAGGAAACAAAGG - Intronic
1135467158 16:22697045-22697067 AAATATTAACTGGAAAACAATGG - Intergenic
1135998426 16:27270848-27270870 ATAGTTTAACTTTGAAACAAAGG - Intronic
1136040647 16:27576124-27576146 AGAAATTAACTGGGAAACCATGG + Intronic
1136144174 16:28306099-28306121 AGAGATGAACAAGTAACCAAAGG + Intronic
1138075608 16:54039405-54039427 AGAGATCAAGAAGGAAACATAGG + Intronic
1139121224 16:64019913-64019935 AGATATTAAATAGGATTCAAGGG + Intergenic
1140197459 16:72866890-72866912 AGAGAATGACCTGGAAACAATGG + Intronic
1143205670 17:5138235-5138257 AGAAACTAACAAGGAAGCAAGGG + Exonic
1143858622 17:9871689-9871711 AAAGAATAACTAGGAAAAGAGGG - Intronic
1144019446 17:11227110-11227132 TGATTTTAACTAGGAAACAAAGG - Intergenic
1144095008 17:11892504-11892526 TGAGAATAACTAGAAGACAAAGG - Intronic
1144876712 17:18400923-18400945 AGAAACTAACAAGGAAGCAAGGG + Intergenic
1145155515 17:20543496-20543518 AGAAACTAACAAGGAAGCAAGGG - Intergenic
1146161612 17:30562879-30562901 AGAAACTAACAAGGAAACATGGG + Exonic
1146887329 17:36481347-36481369 AGAGATTAAAAAGGTAAAAATGG + Intergenic
1148402046 17:47372158-47372180 AGAGAAAAATAAGGAAACAAAGG - Intronic
1148629350 17:49094595-49094617 CAAGATTAAATAGGAAAGAATGG - Intergenic
1149219834 17:54404009-54404031 AGAGATAAACTAGGGAAGGATGG - Intergenic
1149563891 17:57628283-57628305 TGAGATGAATTAGGAAGCAAAGG + Intronic
1150192143 17:63254141-63254163 AGAAATTAAAGAGGACACAAAGG - Intronic
1150668249 17:67165554-67165576 TGAGATTAAAAAAGAAACAAAGG + Intronic
1152589423 17:81204104-81204126 AGAGAGCAACTGGGACACAAGGG + Intronic
1156954122 18:42940965-42940987 AGATATCAACTAGGAATAAATGG - Intronic
1156996273 18:43471538-43471560 AAAGATAAAAAAGGAAACAAGGG + Intergenic
1157634124 18:49132431-49132453 AGAGAATAACCATGAAAAAAGGG + Intronic
1157803009 18:50636120-50636142 AGAAATTAACTAGGCAAGGAGGG - Intronic
1158120722 18:54045627-54045649 AAAGATTAACTAGGAGAAACAGG + Intergenic
1158794498 18:60826941-60826963 AGAAATTAAATAGGACACAAAGG + Intergenic
1158799791 18:60892813-60892835 AGAGATTAACAAGGAATAATAGG - Intergenic
1159367423 18:67486566-67486588 AAAAAATAACTAGAAAACAAGGG + Intergenic
1159756037 18:72367304-72367326 AGTGATTAAATAGGAAAAAAGGG + Intergenic
1164744079 19:30598803-30598825 AGAAATTGACTAGTAAACTAAGG - Intronic
1165430999 19:35772780-35772802 AGAAATTATCTAGTTAACAAAGG + Intergenic
925365108 2:3305873-3305895 ACAGAATAAATAGGAAAGAAAGG - Intronic
925408138 2:3621606-3621628 AGAGAGGAAGAAGGAAACAAAGG - Intronic
925509048 2:4603963-4603985 ATAATTTAACTAGGAAACGAAGG + Intergenic
925659705 2:6189289-6189311 TGAGATTACCTAAGGAACAAAGG + Intergenic
926835406 2:17013696-17013718 AGTGACTTATTAGGAAACAATGG + Intergenic
926875972 2:17479253-17479275 AGAAATTAAATAAGAAAGAAGGG + Intergenic
927272681 2:21230017-21230039 AGAGATGTAGGAGGAAACAAGGG - Intergenic
927329412 2:21844381-21844403 AGAGATGAAAAAAGAAACAAAGG - Intergenic
927376899 2:22427733-22427755 AGAGATTCACTAGGACTCAGAGG + Intergenic
928793302 2:34984876-34984898 AGAGATGGGCTAAGAAACAAAGG - Intergenic
929414994 2:41738189-41738211 AGAGATAAAATATGAAAGAATGG + Intergenic
929763027 2:44821536-44821558 AGAGAAAAACAAGGAAAAAAGGG + Intergenic
930231297 2:48846532-48846554 GGAGATGAATTAGGAAACTAAGG + Intergenic
930252954 2:49056063-49056085 AGAGAGGAAGTAAGAAACAAAGG + Intronic
935125557 2:100219598-100219620 AAAGATAATCTAGGAAGCAAAGG - Intergenic
935500132 2:103829376-103829398 AGTGTTAAACTTGGAAACAAAGG - Intergenic
935672752 2:105569954-105569976 AGAGATTACCTAAGAAGCGAGGG - Intergenic
937393650 2:121515594-121515616 AGATATTAACTGGAAAACAAAGG + Intronic
937786125 2:125900523-125900545 ATAATTTAAGTAGGAAACAATGG + Intergenic
937901219 2:127020617-127020639 GGAGATTAACTAGGGGTCAAGGG - Intergenic
939134478 2:138277224-138277246 AAAGATTAACTCACAAACAAAGG - Intergenic
939304921 2:140399599-140399621 AGAGATTAGCCAGCAGACAATGG - Intronic
940185698 2:150982672-150982694 AGAGATTTTCAAAGAAACAATGG - Intergenic
942517894 2:176772953-176772975 AGAGATTTAGGAGGAAAAAATGG + Intergenic
943208387 2:184929822-184929844 AAATATTAACTAGAAAAAAAGGG - Intronic
944385783 2:199163152-199163174 ATAGATTAACTCGAAAACAGTGG - Intergenic
944516513 2:200517546-200517568 ATATATTAACAAGGCAACAATGG + Intronic
945057420 2:205881072-205881094 AGACTTTATCTAGGAAAGAAAGG + Intergenic
946234177 2:218312491-218312513 AGGGGTTAACAAGGAAAAAAGGG + Intronic
946332489 2:219018271-219018293 AGGAGTTTACTAGGAAACAAAGG + Intronic
946345256 2:219104500-219104522 AGAGGTTCCCTAGGAAACAAAGG + Intronic
946803574 2:223447374-223447396 GGAAATTAACTATGAAAAAAAGG + Intergenic
946919962 2:224568709-224568731 AAATATTAACTGGGAAAAAAAGG + Intronic
947045860 2:225982506-225982528 ATAGTTTAACTTTGAAACAAAGG - Intergenic
947247026 2:228060145-228060167 ACAGATTAAATAGGATAGAAGGG + Intronic
948027804 2:234791695-234791717 GGAGAGAAACTAGGAAACAGGGG + Intergenic
1168775465 20:443828-443850 ACAGGTTACCTAGGAAAAAATGG + Intronic
1168989073 20:2078963-2078985 AGAAATAAACTAGGAAGAAATGG + Intergenic
1170069971 20:12356170-12356192 AGATATTAATTAGGTAAAAAGGG + Intergenic
1170154096 20:13253773-13253795 TGAGCTCAGCTAGGAAACAATGG + Intronic
1170215488 20:13886462-13886484 AGAGAATAGCTAGAAAACAGAGG + Intronic
1170506672 20:17033379-17033401 AAAACTTAACTAGGAAAAAAAGG - Intergenic
1171060551 20:21954591-21954613 AGAGATTAAAAAAGAAACATTGG - Intergenic
1171174315 20:23040106-23040128 AGGCATTAACTAGGAAAGGAAGG + Intergenic
1171817251 20:29798150-29798172 CTAGATTAACTAAGAAAGAAAGG + Intergenic
1171841197 20:30213502-30213524 AAAGAATAAATAGGTAACAAGGG + Intergenic
1173007947 20:39155523-39155545 AGAGATTAAGTAGGACATCAAGG - Intergenic
1173635555 20:44553848-44553870 AGGCATTAACTAGGAGAAAAGGG + Intronic
1174994727 20:55553251-55553273 AGAGTTTAACAAAGAAACCAGGG + Intergenic
1177199296 21:17935722-17935744 GGAGAATAATTAGGAAAGAAAGG + Intronic
1178711429 21:34920502-34920524 ACAGCTTAAATATGAAACAAAGG - Intronic
1180511859 22:16099391-16099413 AGAAATTAATTTGGAAAAAACGG - Intergenic
1181122130 22:20677592-20677614 TGAGATTAACTAAGAAAAAAAGG - Intergenic
1181332607 22:22105677-22105699 TGAGATTAACCAAGAAAAAAAGG + Intergenic
1183579869 22:38717669-38717691 ATAGATTAACTGAGAAAGAAAGG + Intronic
1184354888 22:43973222-43973244 ACAGAGAAACTAGGAGACAATGG - Exonic
949142358 3:650135-650157 AGAAATTAGCTAGGTATCAAGGG - Intergenic
949351467 3:3127904-3127926 GCAGATAAACTAGGAAAGAAAGG + Intronic
952031570 3:29148792-29148814 AAAGATAAACTTAGAAACAAAGG - Intergenic
952112899 3:30145177-30145199 ATAGTTTAACTTTGAAACAAAGG + Intergenic
953566706 3:44038097-44038119 AGAGAGAAACAAGGAAAAAATGG - Intergenic
953974061 3:47369520-47369542 AGAGATTGACTAAGAAGCAGTGG - Intergenic
954788041 3:53109295-53109317 AGAGCTTTGCTAGGAAACCAGGG - Intronic
955986200 3:64576516-64576538 AAAGCTTTACCAGGAAACAAGGG + Intronic
956667096 3:71652306-71652328 AGAGATTAAAGAGGAAAGAAGGG - Intergenic
957503464 3:81088838-81088860 AGTGATTAAACAGTAAACAAAGG - Intergenic
958534056 3:95373334-95373356 AGATATTAACAAGGATAAAAAGG - Intergenic
958566367 3:95816313-95816335 ATAGTTTAACTTTGAAACAAAGG - Intergenic
958758599 3:98279566-98279588 AGAAATTCACTGGAAAACAATGG + Intergenic
958861366 3:99448719-99448741 AGAAATAAACTAGGAAAACAGGG - Intergenic
959122410 3:102248275-102248297 AGAGATTTACTAGTATACATAGG - Intronic
959420987 3:106128110-106128132 AGAGATTGAGAAGGAAGCAAAGG - Intergenic
959435949 3:106315306-106315328 CCAGACTAACTAGGAAAAAAAGG - Intergenic
960789313 3:121410418-121410440 AAAGTGTAGCTAGGAAACAATGG + Intronic
961102911 3:124216901-124216923 GGAGACTAACTAAGACACAATGG - Intronic
962489203 3:135875315-135875337 AGAGATCAATAAGGAAACAGAGG + Intergenic
962698428 3:137973575-137973597 AGATATTCACTAGGAAAAGAGGG - Intergenic
963030629 3:140971526-140971548 AGAGATGCACCAGGAAACAGTGG + Intronic
963257788 3:143163075-143163097 AAAGATTAAGTAGGAAAGCATGG + Intergenic
964018126 3:151972934-151972956 AGAGATTAACTAGGAAAGGATGG + Intergenic
964814815 3:160705642-160705664 AGAGGTAAACTAGAAAACAAGGG + Intergenic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
965877791 3:173348962-173348984 AGAGAGTAAGAAAGAAACAAAGG - Intergenic
965931137 3:174044181-174044203 AGAGACCAAGGAGGAAACAATGG - Intronic
966481595 3:180415133-180415155 AGAGATTTACAAGTAAAAAAAGG + Intergenic
966954173 3:184856711-184856733 AGAGACTAGCTAGGAAGCTATGG - Intronic
971083150 4:23239076-23239098 TTAAATTAACTTGGAAACAATGG + Intergenic
971158302 4:24106510-24106532 TGAGATTAAGAAGGAAACTAGGG - Intergenic
971682901 4:29724402-29724424 AGGGATTAAATGGGACACAAAGG - Intergenic
972017608 4:34265925-34265947 AGAGATGAATAAAGAAACAAAGG + Intergenic
972025872 4:34376623-34376645 AGAAATTAACAAGTAAGCAAAGG + Intergenic
972890944 4:43555035-43555057 AGAAATTAAGAAGGAAATAAAGG - Intergenic
973741400 4:53922761-53922783 AGAGATTAAATGTGAAAAAAAGG - Intronic
973754442 4:54060569-54060591 ACAGATTACCTAGGAAATATTGG + Intronic
973766140 4:54164788-54164810 AGTGATTAACTCTCAAACAATGG - Intronic
973974671 4:56250671-56250693 AGGGATTAACTGTGTAACAACGG + Intronic
974283926 4:59838907-59838929 ACAGAATAATTAGGATACAAAGG + Intergenic
974348144 4:60708914-60708936 TGAGATTAGCTAGTAAACCAGGG + Intergenic
976159507 4:82184091-82184113 AGAGCTTAAAGAGGACACAAGGG + Intergenic
976555863 4:86451065-86451087 GGAGATTTACAAGGTAACAAAGG + Intronic
977278203 4:95005622-95005644 AAAGAAAAACTAGGAAAGAAAGG - Intronic
978917297 4:114142927-114142949 TGAGATTAACCAAGAAAAAAGGG - Intergenic
979347915 4:119610849-119610871 AGAGATTAATTAGGGGACTATGG - Intronic
979629234 4:122881166-122881188 AGAGGTTTACAAGGAAAAAATGG - Intronic
979727767 4:123984821-123984843 AGAAAATAACTTGGAAAAAATGG + Intergenic
979803187 4:124937481-124937503 AGAAAGTAACAAGGAAATAAAGG - Intergenic
980284304 4:130762056-130762078 AAAGAAAAACTAAGAAACAACGG - Intergenic
980382041 4:132034604-132034626 AGATATTAAATAGGAAAAACTGG + Intergenic
980591301 4:134892850-134892872 AGACATTAACTAGGCAATAAAGG - Intergenic
980918834 4:139061878-139061900 AGACATGAACTATGAAACCATGG - Exonic
980978744 4:139635864-139635886 AGAGATTAGCTACAAGACAACGG + Intergenic
981413313 4:144458647-144458669 AGAGGTTTAATAGGAACCAAAGG - Intergenic
982396019 4:154916524-154916546 AGAGATAAAAAAGAAAACAAAGG - Intergenic
983539331 4:168891601-168891623 AGAGAGTAAGTGGGAAAGAAAGG + Intronic
983826022 4:172261493-172261515 TGAGATTAACCAAGAAAAAAAGG - Intronic
985105374 4:186494101-186494123 AGAGTTTGACTATGAGACAAAGG + Intronic
986062850 5:4207968-4207990 AGATCTTCAATAGGAAACAAAGG + Intergenic
986403746 5:7405359-7405381 AGAGATCAACTGGGAAACCTAGG - Intronic
987794004 5:22605279-22605301 AGAGATTTATTATGAAACATTGG - Intronic
987843650 5:23254119-23254141 AGACTTTAAGTAGGAAAGAATGG + Intergenic
988950166 5:36248135-36248157 AGAGATTTAGTACGAAAGAAAGG - Intergenic
989708429 5:44366570-44366592 AGAGATTAACAAGCTACCAAGGG + Intronic
990698542 5:58450410-58450432 AGAGAAAAACTAAGAAAGAAAGG + Intergenic
991802305 5:70382196-70382218 AAAAATTAAAAAGGAAACAAAGG + Intergenic
992427763 5:76675725-76675747 AGTGACTTACTAGAAAACAAAGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993702022 5:91130133-91130155 AAAAATTAAATAGGAAAAAAGGG + Intronic
994044636 5:95294296-95294318 ATAGAGCAACTAGGAAACCAAGG + Intergenic
994475791 5:100267191-100267213 ATAGAATTATTAGGAAACAATGG + Intergenic
994555672 5:101298908-101298930 AGAGGTGAACAAGTAAACAAAGG + Intergenic
994869141 5:105321531-105321553 AGAGGTTAACTAGGTAGCCAAGG + Intergenic
994903364 5:105804168-105804190 AAGAATAAACTAGGAAACAATGG + Intergenic
995113474 5:108453749-108453771 AGAGATTTAGGAGGAAAAAATGG + Intergenic
995944735 5:117630411-117630433 AGAGACTAAAAAGGATACAAAGG - Intergenic
996039769 5:118796631-118796653 AGAAAGTAACTAGAAAATAAGGG + Intergenic
996091783 5:119358561-119358583 ATAGAATAAATAGGAAAGAAGGG + Intronic
996622775 5:125529758-125529780 AGATATTGACTAGAAAACAATGG - Intergenic
998219762 5:140267386-140267408 AGAGATTAACCAGGCAACTGTGG - Intronic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
998909967 5:146948559-146948581 ATATATTAAGTAGAAAACAAAGG + Intronic
1000777332 5:165436692-165436714 AGAGATCAATTAGGAAACAGTGG - Intergenic
1001034512 5:168288073-168288095 AGAAATTAAATATAAAACAAAGG - Intergenic
1001370286 5:171193118-171193140 AGAGATAAACAAGGAGACATAGG - Intronic
1003653407 6:7983511-7983533 CAAGATTGACAAGGAAACAAAGG - Intronic
1004445357 6:15692920-15692942 ATAGTTTAACTTTGAAACAAAGG + Intergenic
1005298869 6:24451729-24451751 AGAGATTACCTAATAAATAATGG - Intronic
1008302642 6:49860219-49860241 AGAAATTAACAAAGAAACATTGG + Intronic
1008611980 6:53192687-53192709 AAGGGTTAAGTAGGAAACAATGG - Intergenic
1008731574 6:54489524-54489546 AAAAATTAACAAGGAAACATTGG - Intergenic
1009637895 6:66290052-66290074 GGACATTAATTGGGAAACAATGG - Intergenic
1010405901 6:75505542-75505564 AGGGTGTGACTAGGAAACAATGG - Intergenic
1011030756 6:82920166-82920188 TGAGATGAATTATGAAACAAAGG + Intronic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1012264057 6:97119866-97119888 GGAGATTAAGAAGGAAAGAAAGG + Intronic
1012737740 6:102972702-102972724 AGAAATTAACAAGTAGACAAGGG + Intergenic
1012768837 6:103403372-103403394 AGTGAATAAATAGGAAACATAGG - Intergenic
1013773299 6:113650958-113650980 AGAGATTTATTAGGAAAAACGGG - Intergenic
1014329479 6:120043095-120043117 AGACATTAATTAAGAAAGAATGG - Intergenic
1014584094 6:123177138-123177160 AGGGAATAACCAGGAGACAAAGG - Intergenic
1014660128 6:124159709-124159731 AAGGAGGAACTAGGAAACAAAGG + Intronic
1015014087 6:128388910-128388932 GGAGATTAAATAGGAAAGTAGGG - Intronic
1016177735 6:141100568-141100590 TGAGATTAATTAGGAAGAAAAGG + Intergenic
1016512183 6:144855917-144855939 AGAGATTGACTATGAAATATTGG + Intergenic
1018319287 6:162589281-162589303 AGATATTTACAATGAAACAAAGG - Intronic
1018500216 6:164401269-164401291 ACAGATTGACTATGAAATAAAGG - Intergenic
1019090985 6:169533420-169533442 AGTGACTAAATAGAAAACAATGG + Intronic
1019226386 6:170513677-170513699 AGAGGGTAATTAGGGAACAAGGG + Intergenic
1019303300 7:320285-320307 AGAGAGATACTAGGATACAAAGG + Intergenic
1021196000 7:17674860-17674882 AGAAATTCACTAGGAAGAAATGG - Intergenic
1022200116 7:28108410-28108432 AGAGATGAGCTTGGAAACCAAGG - Intronic
1022224035 7:28345110-28345132 AGAAATTAACAAGGAAATACTGG + Intronic
1023432275 7:40107075-40107097 AGAGAATGACAAGGAAAAAAAGG + Intergenic
1023605082 7:41923116-41923138 AGAAATTACCTAGGCAAGAATGG + Intergenic
1026132399 7:67631202-67631224 AGAGATTAATTAAGGAAGAAAGG - Intergenic
1028042409 7:86070744-86070766 AGAGATGAACTAAGAAGCATAGG - Intergenic
1030837192 7:114303568-114303590 AGAGATTAACTAGGAAACAAAGG - Intronic
1030885388 7:114930151-114930173 AGAAATTAACTAGGACTGAATGG + Intronic
1031775452 7:125903192-125903214 AGAGATAAAGGAGGAAACATGGG + Intergenic
1036969147 8:13334514-13334536 GGAGACCAGCTAGGAAACAATGG + Intronic
1037386552 8:18348808-18348830 AGAAATCAACAAGGAAACACTGG + Intergenic
1039224882 8:35377625-35377647 ACAGACAAACTAGGGAACAAGGG - Intronic
1039748378 8:40453876-40453898 AGACCTTAACTAGTAAAGAATGG - Intergenic
1040509931 8:48084626-48084648 AGAAAGTAACTAGGAGACATGGG + Intergenic
1040731366 8:50451398-50451420 ACAGATTACCTAGGAACAAATGG + Intronic
1040990482 8:53344364-53344386 ACAGACAAACTAGGAAAGAAAGG + Intergenic
1041284287 8:56244424-56244446 AGAGATTCAGGAGGAAACACTGG + Intergenic
1041417962 8:57634424-57634446 AGAGATTATGTGGGAAACTAGGG + Intergenic
1041814620 8:61955372-61955394 ACAGATTTTCTAGGAAAGAAAGG + Intergenic
1043203605 8:77406932-77406954 AAACATTATCTAGGAAATAATGG + Intergenic
1043318991 8:78958142-78958164 AGAGATAAAGAAGGAAACAGTGG + Intergenic
1043319858 8:78970976-78970998 AGAGATGAACTATTAAACTAAGG - Intergenic
1043537548 8:81222710-81222732 AGAGATCAACTAAGAAAAGAAGG - Intergenic
1043565735 8:81545300-81545322 AGGGAGTCACTGGGAAACAAGGG + Intergenic
1043744691 8:83859405-83859427 AGAGGTTAACAAGGAACAAAGGG + Intergenic
1046112028 8:109737046-109737068 AGGTATTAATTTGGAAACAATGG + Intergenic
1047744460 8:127833818-127833840 TAATATTAACTAGAAAACAATGG - Intergenic
1047891335 8:129314587-129314609 AGAGGTTAACTAGGAAAAATTGG + Intergenic
1048095679 8:131290424-131290446 ACAGATTAAATAAGTAACAATGG - Intergenic
1049334232 8:142074144-142074166 AATGATTAAATAGAAAACAAGGG + Intergenic
1050014866 9:1223002-1223024 AGAAATTAAGTAAGAAACAATGG + Intergenic
1051020344 9:12535144-12535166 AGAGATTTAGGAGGAAAAAATGG - Intergenic
1051371892 9:16365806-16365828 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1051687827 9:19676498-19676520 ATAGATAAACAAGGAAACAAAGG - Intronic
1051857968 9:21591243-21591265 AAAGATTAACAATGAAAGAAAGG - Intergenic
1052243370 9:26302540-26302562 AGAGATTTCCTAGGACACAAGGG + Intergenic
1053200904 9:36151046-36151068 AGAGATTAAACAGGAAGGAAAGG - Intronic
1054954440 9:70892066-70892088 AGGGATTTACGAGGAAAAAAAGG + Intronic
1055359322 9:75472555-75472577 AGATGTTACATAGGAAACAAAGG + Intergenic
1057090533 9:92254241-92254263 AGAGATCAAGTAGGAAAGAAAGG + Intronic
1057977913 9:99626300-99626322 AGAGAGAAGCTAGAAAACAAAGG + Intergenic
1058392595 9:104512733-104512755 AAAAATTAATCAGGAAACAAAGG + Intergenic
1061819012 9:133213484-133213506 AGAGAAAAACAATGAAACAAGGG + Intergenic
1203610859 Un_KI270749v1:1914-1936 AAAGAATAAATAGGTAACAAGGG - Intergenic
1186586357 X:10877477-10877499 AGAGAGTACCTAGGGCACAATGG - Intergenic
1186934980 X:14439490-14439512 AGAGAGAAACAAAGAAACAAAGG + Intergenic
1186956921 X:14692902-14692924 AAAGTATAACTAGCAAACAAGGG + Intronic
1187124412 X:16440482-16440504 ATAGCTGAACTAGGACACAATGG + Intergenic
1188578890 X:31686497-31686519 AGGCATTAAATAAGAAACAAAGG - Intronic
1189894219 X:45636953-45636975 CTAGATTAACAAAGAAACAAAGG + Intergenic
1190332483 X:49244408-49244430 AGAGATTAAGAAGTAAACAGAGG - Intronic
1190932683 X:54962662-54962684 TGAGATTAACAAGGAAAAGAAGG + Intronic
1191640190 X:63423391-63423413 AGAGAGGAAATAGGAAACAAAGG - Intergenic
1192098150 X:68235144-68235166 AAAGTTTAACTAGAAAGCAAGGG + Intronic
1192548995 X:72038810-72038832 AGAGATAAAATAGGACATAATGG + Intergenic
1193209445 X:78788857-78788879 ACAGAATAACTAAGAAAAAAAGG - Intergenic
1193240236 X:79160190-79160212 AGAGATCAAGTAGAAAAAAAAGG - Intergenic
1194141095 X:90210635-90210657 AGAAATCAATAAGGAAACAACGG + Intergenic
1194368611 X:93041280-93041302 AGAGACTAACAAAGAAACATTGG - Intergenic
1194530868 X:95046636-95046658 AAAGAATAAATAGAAAACAATGG + Intergenic
1194648359 X:96485940-96485962 AGATATTAACTAGAAGAGAAGGG - Intergenic
1194773886 X:97939053-97939075 AGGGATTAAATAGGACCCAAAGG - Intergenic
1195667566 X:107444819-107444841 AGAGAAGATCTAGGAATCAAAGG + Intergenic
1195850049 X:109273105-109273127 AGAGATAAATTAGGAATAAAGGG + Intergenic
1196074381 X:111559304-111559326 AGAGTTTAGCTTTGAAACAAAGG + Intergenic
1196122201 X:112063278-112063300 AGAGATGAATCAGGAAACAATGG - Intronic
1196733675 X:118965656-118965678 AGAAATCAACAAGGAAAAAAAGG - Intergenic
1196987360 X:121289670-121289692 AAAGGTGAACTAGGTAACAAGGG - Intergenic
1197448650 X:126582722-126582744 AGAGAGGAAGTAAGAAACAAAGG + Intergenic
1199030834 X:142997518-142997540 ATAGATTTACTACCAAACAAGGG - Intergenic
1199144554 X:144349908-144349930 AGAGTTTAACTGGGGTACAATGG + Intergenic
1200486857 Y:3779753-3779775 AGAAATCAATAAGGAAACAATGG + Intergenic
1201523969 Y:14910426-14910448 AGAGAATAAAACGGAAACAATGG - Intergenic
1201741833 Y:17332515-17332537 AGAGAATAACAAGGAGATAATGG - Intergenic
1202329229 Y:23728899-23728921 AGAGGATGACTAAGAAACAACGG - Intergenic
1202541542 Y:25941155-25941177 AGAGGATGACTAAGAAACAACGG + Intergenic