ID: 1030845722

View in Genome Browser
Species Human (GRCh38)
Location 7:114407907-114407929
Sequence AAGCTGTCCTTGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030845722_1030845723 20 Left 1030845722 7:114407907-114407929 CCATGTTTCATCAAGGACAGCTT 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1030845723 7:114407950-114407972 TAATTAAAAATCTGCTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030845722 Original CRISPR AAGCTGTCCTTGATGAAACA TGG (reversed) Intronic
903078745 1:20791887-20791909 AACCTGTCCTTGTTAACACAAGG - Intergenic
904307975 1:29602508-29602530 AAATTGTCCCTGATAAAACAGGG + Intergenic
905059684 1:35129224-35129246 AAGTTGTCCTAGCTGAAATATGG - Intergenic
906881560 1:49596949-49596971 AAGCTGTCCTTGTTTCACCAGGG - Intronic
909071543 1:70999899-70999921 AAGTGGTCCTGGATCAAACAAGG + Intronic
912153974 1:106893058-106893080 AAACTGTCCTTGAAAAAATATGG + Intergenic
912692728 1:111816374-111816396 AAGCTTTCCTGGAGGAAACAAGG - Intronic
912761898 1:112375163-112375185 AAACTATCCAAGATGAAACACGG + Intergenic
913324261 1:117612938-117612960 AAGCAGCCTTTGATGAAACCCGG + Intronic
915248661 1:154573029-154573051 CAGCTGTCCTAGAGGAAACCTGG - Intronic
916597197 1:166255669-166255691 AAGCTGTCCTTCATAAAAGAAGG - Intergenic
919120365 1:193332837-193332859 AAGCTGTCCTTCAGGAATGAAGG - Intergenic
921050918 1:211510969-211510991 AAGTAGTCCTTGAAGAAACCAGG - Intergenic
923010405 1:230083666-230083688 AAGCTGTCCTTGCTGTTAAACGG + Intronic
924152948 1:241147154-241147176 AAGGTGGCCTTGATGAAAAATGG - Intronic
924198115 1:241631030-241631052 ATACTGTCCTTCATGATACATGG + Exonic
1064842222 10:19606405-19606427 AAGCTGTTCTTGTTGAACCTGGG + Intronic
1067052787 10:43032505-43032527 AAACTGTCTCTGAAGAAACATGG + Intergenic
1067918430 10:50426488-50426510 AAGCAGACCTTACTGAAACATGG + Intronic
1068572156 10:58642068-58642090 AAGCTGGCCTTGAAGAGACCTGG - Intronic
1070539347 10:77405047-77405069 AAAATGTGCTTGAGGAAACAAGG + Intronic
1070680228 10:78443831-78443853 AAGCTGTCCTGGTTGAATCAAGG - Intergenic
1071106586 10:82104438-82104460 AAGCTGTCATTTAGGAAGCAGGG + Intronic
1074543340 10:114384293-114384315 AAGATGCCATTGATGAAGCAAGG - Intronic
1074938817 10:118214923-118214945 CAGATGGCCCTGATGAAACAAGG - Intergenic
1075379361 10:122006025-122006047 AAGCTGTTCTTCATGTATCAAGG - Intronic
1076105734 10:127822281-127822303 AAGCTGTCCTTGATCATTCCTGG + Intergenic
1077637159 11:3850955-3850977 AAGCTCTGCTAGATAAAACAGGG - Intergenic
1078533476 11:12154996-12155018 AAGCTGTCTTCTATCAAACAAGG + Intronic
1087559726 11:99772578-99772600 AAGTTGTCCTTTATTAGACAAGG - Intronic
1087566070 11:99859657-99859679 AAGATGTCTTTGAAGCAACATGG - Intronic
1087970594 11:104476950-104476972 AAATTGTCCTTGAAGAAAAATGG + Intergenic
1089122436 11:116146806-116146828 AAGTTGTCCATGATCGAACAAGG + Intergenic
1089188208 11:116635421-116635443 AAGCTGTGGTTGGTTAAACAGGG + Intergenic
1090751008 11:129746565-129746587 AAGGTGTTCTGGGTGAAACAGGG + Intergenic
1091251823 11:134150503-134150525 GAGCTGTGCTGGATGAAGCAAGG - Exonic
1093101875 12:15037848-15037870 AAGCTGTCCTTGTTGATTCCCGG - Intergenic
1095809189 12:46353935-46353957 GAGCTCTGCTTGTTGAAACAGGG - Intergenic
1096997799 12:55849866-55849888 AGGCTGTCCTTGATGACGAAGGG + Intergenic
1098006119 12:65998740-65998762 AAGGAGGCCATGATGAAACAGGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099423191 12:82489736-82489758 AAGCTGTCCTTCAGGAATGAAGG + Intergenic
1099684565 12:85868172-85868194 AAGTTGTCCTTGAGGAAAACTGG - Intergenic
1100384618 12:94094110-94094132 AAGTTGTCAGTGATGGAACAGGG - Intergenic
1105691119 13:22840297-22840319 AAGCTCTCCTTGATTCCACAAGG - Intergenic
1106121920 13:26867045-26867067 AACCTGTCCTTGATGATACATGG - Intergenic
1106547850 13:30745786-30745808 AAGGTGTCTTTGATGAGGCAAGG + Intronic
1106734130 13:32571947-32571969 AAGCTGTCCTTGTTGGGACAGGG - Intergenic
1106945478 13:34823135-34823157 ACACTGGCCTTGATGAAACCTGG + Intergenic
1107479356 13:40772377-40772399 TACCTGTCCCTCATGAAACAGGG + Intergenic
1107625580 13:42279406-42279428 AAGCTATCCAAAATGAAACATGG - Intronic
1110873240 13:80477703-80477725 AAACAGTCTTTGATAAAACAGGG - Intergenic
1111438833 13:88250418-88250440 AAGGGCTTCTTGATGAAACATGG - Intergenic
1113389619 13:109882861-109882883 AGGCTGTCCTTCATGACACCGGG + Intergenic
1115349083 14:32373698-32373720 AAGCTGTCCTTGTTGATTCCTGG - Intronic
1118182272 14:63505572-63505594 AAGCAGTCCTTGATAAAGTATGG + Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1119942316 14:78654356-78654378 AAGTTGTCCTAAATGAAACAAGG + Intronic
1120588305 14:86344325-86344347 AAACTGTCCTTGAGAAAAGATGG - Intergenic
1121151435 14:91638729-91638751 AGGTTGTCCCTGAAGAAACATGG - Intronic
1122642242 14:103166752-103166774 AAGCTATCCATGATTGAACAGGG + Intergenic
1123109732 14:105860389-105860411 AAGCTGACCTAGACTAAACAAGG - Intergenic
1123816411 15:23983840-23983862 AAGTTGTCCTTGTTCAATCATGG - Intergenic
1124603650 15:31154508-31154530 AAGCTGTCCTTGATCATTCCTGG + Intronic
1126829982 15:52592035-52592057 AAGCTTTCCTTGAAGAAACTGGG + Intronic
1127749034 15:62014381-62014403 ATGCTGTCCTTGTAGAAACTTGG - Intronic
1127837800 15:62804799-62804821 AAGCCTTCCTTGCTGAAACATGG + Intronic
1128351823 15:66895885-66895907 AAGCTGTCCTTGATCATTCCTGG - Intergenic
1128372049 15:67047538-67047560 AATCTGCTCTGGATGAAACAGGG - Intergenic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129932253 15:79421661-79421683 AATCCATCTTTGATGAAACATGG + Intronic
1130194564 15:81767299-81767321 ATGCTCTCCTTTATGAAGCATGG + Intergenic
1131649566 15:94383920-94383942 AAGTTGTGCTTGCTGAAAGAGGG - Intronic
1134265604 16:12690201-12690223 ATGGTGTCTTTCATGAAACAGGG - Intronic
1135998432 16:27270907-27270929 AAGCTGTCCTTGATCATTCCTGG - Intronic
1140154101 16:72404534-72404556 AAGATATCCTTATTGAAACAAGG + Intergenic
1140787352 16:78355510-78355532 AAGAATTACTTGATGAAACATGG + Intronic
1144301325 17:13924919-13924941 AAGTTGTCCATGATCAACCAGGG + Intergenic
1146576675 17:33999992-34000014 AAGCTGTCCTTGAGAAATGAAGG - Intronic
1147235322 17:39052919-39052941 ATGCTGCCCGAGATGAAACAGGG + Intergenic
1147530962 17:41276680-41276702 AAGCTGTCCTTCATCTCACATGG + Exonic
1153689835 18:7581141-7581163 AAGCTGGCCTGCATCAAACAGGG + Intronic
1155715041 18:28931979-28932001 AACCTGCCCCTTATGAAACATGG - Intergenic
1156139894 18:34094942-34094964 AAGATGTCATTTATGAAACCAGG - Intronic
1157038352 18:44005505-44005527 AAGCTGTCCTTGTTTAATCTTGG - Intergenic
1159775707 18:72601238-72601260 AAGCTGTCCTTGGTCAATCCGGG - Intronic
1164864279 19:31590952-31590974 CAGCTGTCCTTCAGGAAAGAGGG + Intergenic
1166337050 19:42114605-42114627 TAGCTGTCCTTCACGGAACATGG - Intronic
1168725955 19:58582134-58582156 AAGGAGCCCTTGAGGAAACACGG - Intergenic
926758924 2:16260192-16260214 AAGGTGTCCTTGGAGGAACATGG + Intergenic
927663207 2:25010255-25010277 AGCCTGTCCTTGACTAAACAAGG + Intergenic
928167420 2:28981294-28981316 AAGCTCTCCTTGAATAAACAAGG - Exonic
929329698 2:40666413-40666435 TAGTTGTCCTTCATGAAACATGG + Intergenic
931149036 2:59552063-59552085 TACCTGTCCTTCATGAAACATGG - Intergenic
931483151 2:62663362-62663384 AAACTGTTCTTGATGCAAAAAGG + Intergenic
932410738 2:71546060-71546082 GAGCTGTCCTTGATGACTCTCGG + Intronic
932846184 2:75137973-75137995 AAGCTGTCTTGGATGTAAAAAGG - Intronic
936279533 2:111125187-111125209 CAGCTGTCAATGTTGAAACAGGG - Intronic
936684961 2:114816906-114816928 AAGCTGACCTGTATGAAACAAGG + Intronic
937789247 2:125941828-125941850 AAGCTGTCCTTGTTCATTCATGG + Intergenic
938699449 2:133863176-133863198 AAGCTGCCCCTGATGAAAATAGG + Intergenic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
939958740 2:148547802-148547824 AAGCTGCCCTTGAAGAAAGGGGG - Intergenic
944210929 2:197205792-197205814 AAGCCTTCCCTGATGACACAAGG - Intronic
946668654 2:222078195-222078217 AAGCTGTAATTGTTGAGACAGGG + Intergenic
947349575 2:229229067-229229089 AAGCTGTCCTAGATGACATTGGG - Intronic
1169872049 20:10258412-10258434 AAACTATCCATGATCAAACATGG + Intronic
1170733258 20:18991987-18992009 AAGCTGTCCTTGATTATTCCTGG + Intergenic
1173793491 20:45842868-45842890 AAGCTTTGCTTGATAAACCAAGG - Intronic
1174225778 20:48998624-48998646 AAGCTGTCCTTGACTGCACAGGG - Intronic
1174348440 20:49949152-49949174 AAGCTGTCCTGGAAGAAAGGAGG + Intronic
1177362751 21:20094624-20094646 AATCTCTACATGATGAAACATGG - Intergenic
1177717834 21:24863098-24863120 TAGCTGTCTATGAGGAAACAGGG + Intergenic
1181304974 22:21910814-21910836 AAGCTGTCCTTGATCATTCCTGG - Intergenic
1183258378 22:36777796-36777818 AAGTTCTCCTTGATCAAAAACGG + Intergenic
1185236016 22:49713507-49713529 AAGGTGTCTTTGATAACACAGGG - Intergenic
1185385212 22:50528800-50528822 TACCTGTCCTTGGGGAAACAAGG + Intronic
950273483 3:11638922-11638944 AAGTTGCCCGTGATGAAACAAGG + Intronic
950626540 3:14251606-14251628 AAGCTGTCCTTGGTCAATTATGG - Intergenic
952084394 3:29799945-29799967 AAGTTGTCCATGATGAACAAAGG - Intronic
952937934 3:38415244-38415266 AAGCTGTCCTTTAAGTATCAAGG + Intronic
954907792 3:54077489-54077511 AATGTGTCCCTGAGGAAACAGGG - Intergenic
955276636 3:57553336-57553358 TAGCTGTCCTGGATGCCACATGG - Intergenic
955745833 3:62139654-62139676 AAGCTTTTCTTGTCGAAACACGG + Intronic
958096311 3:88949981-88950003 AAACTGTCCTTGATGAATTTAGG + Intergenic
958522964 3:95214819-95214841 AAGCTGTCCTTGATAATTCCTGG - Intergenic
960373425 3:116868971-116868993 AGTCTGTTCTTGATGATACATGG + Intronic
960939153 3:122922314-122922336 ACGCTGTCCTGGGTGACACAGGG + Exonic
961597908 3:128033827-128033849 AAGCTGTTTTTGATGAACCGTGG - Intergenic
964066826 3:152590204-152590226 AAGTTCTCCTTGATGAAAGAAGG + Intergenic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
966327933 3:178777955-178777977 GAGCTGTCCACGATGAATCATGG - Intronic
971233963 4:24824871-24824893 AAACTGTTCATGTTGAAACATGG + Intronic
971913635 4:32829401-32829423 AATTTGTCCTAGGTGAAACATGG - Intergenic
972134435 4:35874466-35874488 TAGCTGTGCTTTATGAAACTGGG - Intergenic
972375720 4:38468221-38468243 AAACTGTCCTTGAGGAATCTTGG - Intergenic
974178191 4:58351717-58351739 AAGCTTTCCTTGAAGAATAAAGG - Intergenic
976600449 4:86933818-86933840 AAGGTGTCCCTGATGAAACCTGG - Intronic
977669519 4:99679913-99679935 AAACTGTCCATGAGGACACAGGG - Intergenic
978019468 4:103789166-103789188 AAGCTGTCCTTGCTTATCCATGG - Intergenic
979580063 4:122347574-122347596 AAGCTTTTCTTGATGATTCAGGG - Exonic
981697191 4:147570773-147570795 AAACTGTTCTTGCAGAAACAGGG + Intergenic
983159786 4:164398128-164398150 GCCCTGTGCTTGATGAAACAAGG + Intergenic
984108217 4:175576782-175576804 AAGCTGTTACTGAGGAAACATGG - Intergenic
985206075 4:187538546-187538568 AGACTGTCCTTTCTGAAACAAGG + Intergenic
986218866 5:5748471-5748493 AAGTTGTCCTCCATGAAAAAAGG - Intergenic
986366693 5:7039966-7039988 AAACTGTCCCTCATTAAACATGG + Intergenic
986887694 5:12260350-12260372 AAGCTGTCCTTGCTGAGACTTGG - Intergenic
988441334 5:31237104-31237126 CAGCTGTCCTCTCTGAAACACGG - Intronic
988882695 5:35520595-35520617 AAGCTGTCCTTGGTCAATCCTGG - Intergenic
989401941 5:41017176-41017198 GGGCTGTCCTTGGTGAAACATGG + Intronic
989590607 5:43109561-43109583 AAAATGTCCATGAGGAAACAAGG + Intronic
992472098 5:77068002-77068024 AAGCTGTGACTGAAGAAACATGG + Intergenic
997085980 5:130799244-130799266 AAGCTGTCCTTGAGAAATGAAGG + Intergenic
997109162 5:131055690-131055712 AAGCAGTCCTTCATGAATGAGGG + Intergenic
997768483 5:136528908-136528930 AAGTTGTGCTAGATAAAACATGG - Intergenic
1001316427 5:170644253-170644275 ATGGTGTCCATGAAGAAACAAGG + Intronic
1004590739 6:17049241-17049263 AAAATGGCCTTGATGCAACAAGG + Intergenic
1005938475 6:30543110-30543132 AAGCTGGTCTTGGTGAATCAGGG - Exonic
1009651842 6:66486133-66486155 GAGCTGTCCTTGCAGAAACTGGG + Intergenic
1011053367 6:83178499-83178521 TAGTTGTCCTTGATGAATAAAGG - Intronic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1013452445 6:110297882-110297904 AAGTTGTTCTTGAAGAAGCATGG + Intronic
1014204381 6:118641157-118641179 TAGATGTCCTTGATTAAATAGGG - Intronic
1015279865 6:131421545-131421567 AAGCTGTCCTGGGGGAAGCAAGG - Intergenic
1016843559 6:148548237-148548259 AAGTAGTCCTCGATGACACATGG + Intronic
1017289113 6:152714324-152714346 AAGCAGAACTTAATGAAACAGGG - Intronic
1018977551 6:168576711-168576733 AAGGTTTCCCTGAGGAAACAAGG + Intronic
1020411735 7:7899878-7899900 ATACTGTCCTTTATGAAACTGGG - Intronic
1023274029 7:38498862-38498884 AAACTGAGCTGGATGAAACATGG - Intronic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1024841954 7:53596963-53596985 AATCTCTCTTTGATGAAAAAAGG - Intergenic
1025062896 7:55826490-55826512 AAGCTGTCCTTTAAGAATAAAGG + Intronic
1026324473 7:69296881-69296903 AAGATGTCCTTGATGATATATGG - Intergenic
1028991865 7:97057601-97057623 AAGACCACCTTGATGAAACAAGG + Intergenic
1030334626 7:108311361-108311383 CAGGTGTTCTTTATGAAACAAGG + Intronic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1033918403 7:146356964-146356986 AAGCTGTGCTTGATGAGATGAGG - Intronic
1036996817 8:13667552-13667574 GAGCTGTCCCTGATCACACACGG + Intergenic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1043254325 8:78114726-78114748 AAGCTGTGATTGATCAAAGATGG - Intergenic
1043331105 8:79120017-79120039 AGGCTGTCCTTTATGGTACAGGG - Intergenic
1043403579 8:79907991-79908013 AAGTTTTCCTTGATGACTCAGGG - Intergenic
1044080727 8:87879718-87879740 ATGCTTTCTTTGGTGAAACAGGG + Intergenic
1050061437 9:1713637-1713659 AAACTGTCCTTCATCAAGCAAGG + Intergenic
1050482121 9:6097954-6097976 AAGCTGTCCTTGGTCATACCTGG - Intergenic
1050766923 9:9145951-9145973 AAGATGTCCTTCATGAAGAACGG + Intronic
1051234628 9:14986234-14986256 CAGTAGTCCTTGGTGAAACATGG - Intergenic
1051786138 9:20745783-20745805 AAGCTGTACTTTCTGAAATAAGG + Intronic
1056698509 9:88880957-88880979 AAGCTGTCCTTGATGACAATGGG - Intergenic
1057235877 9:93359487-93359509 AAGCTGTCCTTGTTCATACCTGG - Intergenic
1057932739 9:99210228-99210250 AAGCTGTCCTTCATAAATGAAGG - Intergenic
1058828521 9:108795614-108795636 AAGCTATCCATGATAAACCAGGG + Intergenic
1060716692 9:125937524-125937546 AGGCTGACCTGGAAGAAACAAGG - Intronic
1187151555 X:16685948-16685970 AAGCTGTCCCTGTTTAATCAGGG + Intronic
1187768071 X:22665041-22665063 AAGCTGTGCTTGTAGCAACAGGG + Intergenic
1188765665 X:34088369-34088391 AAGCTGTCATTGATAAATTAAGG + Intergenic
1192744864 X:73928997-73929019 AAGCTGTCCTTTAAAAAACTAGG - Intergenic
1195415543 X:104616337-104616359 AAGCTGTCCTTGTTCATTCATGG + Intronic
1197092802 X:122558735-122558757 AAGCTGTGCTGGATGAAGGATGG - Intergenic
1198865784 X:141121422-141121444 AAGCTGCCCTTGCTGCAACTAGG + Intergenic
1200135043 X:153870682-153870704 AAGCTGTTCTTGAGGAAGCCTGG + Intronic
1201339973 Y:12923828-12923850 AAGCTGTCCATGACTAACCAGGG - Intergenic