ID: 1030849931

View in Genome Browser
Species Human (GRCh38)
Location 7:114471365-114471387
Sequence GGTGGGAAATGATACCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030849931 Original CRISPR GGTGGGAAATGATACCTGAA TGG (reversed) Intronic
904217766 1:28937112-28937134 GGTGTGAAATGGTACCTCATAGG + Intronic
904854368 1:33485965-33485987 GGTGGGACAGGATGCCTAAAGGG + Intronic
907353010 1:53849034-53849056 GGTGGGAAATGGAACATGAGGGG - Intergenic
907426336 1:54381671-54381693 GGTGGTAAATGATACCTTTGTGG - Intronic
907533886 1:55130028-55130050 TGAGGGAACTGAGACCTGAAAGG + Intronic
909432059 1:75599831-75599853 GGTGGGAAATGAACCTGGAAGGG + Intronic
909969614 1:81965976-81965998 GGAGGCAAATGATAACTGTATGG - Intronic
914357048 1:146895819-146895841 GAAGGGAAATGATACCAGATGGG + Intergenic
914783088 1:150803500-150803522 GGAAGGAAATCATATCTGAAAGG - Intronic
917597296 1:176542314-176542336 GGTGAGAAATGATATCAAAATGG + Intronic
918255596 1:182743576-182743598 AGTGGGAAATGATGCTGGAAGGG - Intergenic
918926151 1:190789196-190789218 AGTGGGAAATGATATCAGAGAGG - Intergenic
920945159 1:210522231-210522253 GGTGAGAAATGACACCTGGGAGG + Intronic
923416845 1:233770762-233770784 GTTGGGAAATGGGACCTAAAGGG + Intergenic
1064880753 10:20050646-20050668 GGTGTGAAATGATATCTCATTGG - Intronic
1067304844 10:45053136-45053158 AGAAGGAAATGATACCAGAAAGG - Intergenic
1068640774 10:59404336-59404358 GGTGGGACCAGATACCTGAGTGG + Intergenic
1069543481 10:69312954-69312976 GGTGGGAAATGTGTCCTGAAAGG + Intronic
1070541761 10:77420482-77420504 TGAGGGGACTGATACCTGAAAGG - Intronic
1070558303 10:77546708-77546730 GATGGGAAAGGAGGCCTGAAGGG - Intronic
1072106240 10:92277058-92277080 GTTTGGAAATCATATCTGAACGG - Intronic
1073293308 10:102423981-102424003 GCTGGGAAAAGATACCTGGTTGG + Exonic
1078341762 11:10502277-10502299 CCTGGGAGATGATCCCTGAAGGG - Intronic
1079023528 11:16927446-16927468 GGTGGGGAAAGATAACAGAAGGG - Intronic
1079387796 11:19996378-19996400 TGGGGAAAATGATACCTGGAAGG - Intronic
1081201259 11:40218810-40218832 GGTAGGAGATGAGACCAGAAAGG - Intronic
1081385696 11:42469686-42469708 GGTGGGATATGAAACCAGAAGGG + Intergenic
1084726922 11:70947936-70947958 GGTGGGAAATGAGACCACAGAGG - Intronic
1085747345 11:79126485-79126507 GGTGGGCATTGCTACCTTAATGG + Intronic
1087083512 11:94194678-94194700 GCTGGGAAAGGATACTGGAAAGG + Intergenic
1088695724 11:112364324-112364346 GGTTTGAGATGAAACCTGAAGGG + Intergenic
1089813051 11:121147479-121147501 GGTGGGAAATGGTGCCAGTAGGG + Intronic
1091522887 12:1265694-1265716 GGTGGGGCATGATACTTTAAGGG - Intronic
1091673672 12:2471446-2471468 AAGGGGAAATGATACCAGAAGGG - Intronic
1092999302 12:13980580-13980602 GGTGGGAAAGCCAACCTGAATGG + Intergenic
1095617469 12:44208488-44208510 TGTGGGAAAAGATGCCAGAAAGG - Intronic
1097192617 12:57226695-57226717 GGATGGAAATGAGACCTGAGTGG + Intergenic
1098487959 12:71043649-71043671 GCTGGGAAACCATAACTGAATGG + Intergenic
1098537236 12:71606831-71606853 GTTGGGAAAGGCTCCCTGAATGG - Intergenic
1099834172 12:87886540-87886562 GGTGGGCAAGGCTACCTTAATGG - Intergenic
1102677739 12:114669503-114669525 GGAGGGAAATTATCCCCGAAAGG - Intergenic
1105424834 13:20285212-20285234 GGTTGGAAAGGAGAACTGAAAGG - Intergenic
1105550342 13:21388933-21388955 GGTGAGAAATAAAACCAGAAGGG + Intronic
1105784115 13:23731175-23731197 GGCAGGAAATGCTAACTGAAGGG + Intronic
1107498318 13:40950411-40950433 GGTGGGAAATGAGATTGGAAAGG - Intronic
1108023579 13:46154790-46154812 GGTGGGAAGACATACCTGAATGG + Exonic
1109377973 13:61523172-61523194 GGGGGGAAATGATATGAGAAGGG - Intergenic
1110108805 13:71716406-71716428 TATGAGAAATTATACCTGAAAGG - Intronic
1111924770 13:94451014-94451036 GGTGCTAAATGTCACCTGAATGG - Intronic
1116304961 14:43241263-43241285 GGTTTGAAATGACACCTAAAGGG - Intergenic
1116836214 14:49770772-49770794 GTTAGGAATTAATACCTGAAGGG + Intronic
1117939403 14:60945781-60945803 TGTGCAAAATGATACCTGAATGG - Intronic
1118447288 14:65863409-65863431 GATGGGAAGTGAGAACTGAAAGG - Intergenic
1119565074 14:75621940-75621962 GGTGAGAAATAATCCCTGCATGG + Intronic
1119638012 14:76292540-76292562 TGTGGGAAATGATTTCAGAAAGG + Intergenic
1120793615 14:88607894-88607916 GGTGGGGGATGATACTTGCAGGG - Intronic
1122115737 14:99526450-99526472 GGTGGGAAATGTGAACTGGAAGG - Intronic
1202844186 14_GL000009v2_random:151812-151834 GGAGGTAAATGATATCTAAAAGG + Intergenic
1124169055 15:27355964-27355986 AATGGGGAATGATACCTAAAAGG + Intronic
1125011647 15:34883268-34883290 GCTGGGAAATTAAACCTGCAAGG + Intronic
1125494538 15:40180074-40180096 GAAGGGAAATGATACTAGAAGGG - Intronic
1126992760 15:54401645-54401667 GGAGGGAAAGGATACTTGGAAGG + Intronic
1129931808 15:79417500-79417522 TGTGGTAAATGGTACCTGAAAGG + Intronic
1131038605 15:89242584-89242606 GGTAGAAGATGATTCCTGAAAGG - Intergenic
1134209973 16:12267906-12267928 GGTAGGAAATGAGACCAGAGAGG - Intronic
1139387456 16:66582302-66582324 GGAGGGAACTGTTAACTGAAAGG + Intronic
1139977121 16:70821315-70821337 GAAGGGAAATGATACCAGATGGG - Intronic
1142909205 17:3072601-3072623 CGTGGGAGATGATACCTTTAGGG - Intergenic
1142925355 17:3231637-3231659 CGTGGGAGATGATACCTTTAGGG + Intergenic
1146690582 17:34872459-34872481 GGGGTGAAATGATAACTAAAGGG - Intergenic
1147724732 17:42559716-42559738 GGTGGGAGATGAGATCAGAAAGG - Intergenic
1149337078 17:55646366-55646388 GATGGGAAATACTACCAGAAAGG - Intergenic
1153111917 18:1601250-1601272 GGTTTGAACTGATACCTGATGGG + Intergenic
1153758794 18:8310401-8310423 GGTGGGAAATGAGAACAGAGAGG - Intronic
1154082448 18:11271794-11271816 GGTAGGAAAAGATCCCTGAAAGG - Intergenic
1155007175 18:21740034-21740056 GGAGGGAAATGCTAACAGAATGG - Intronic
1157285946 18:46377523-46377545 TGTGGGAGATGTGACCTGAAGGG + Intronic
1157307877 18:46530196-46530218 GGTGAGAAATGGAAGCTGAAAGG + Intronic
1158019212 18:52821430-52821452 GGTATGAGATGATATCTGAAAGG - Intronic
1158303202 18:56075832-56075854 GGTGGGTTATGATACATAAAAGG + Intergenic
1158387832 18:57014804-57014826 GTTGAGAAATAAAACCTGAAAGG + Intronic
1161721771 19:5906660-5906682 GGTGGGAAAAGATAATGGAAAGG + Intronic
1165083272 19:33323792-33323814 GGTGGCACATGATAGCTAAAGGG + Intergenic
1165158838 19:33804080-33804102 GCTGGGAACTCATACCTGCAGGG + Intronic
1167014820 19:46834217-46834239 GGAGGGAGATGATAGCTAAAGGG - Intergenic
1167538748 19:50072236-50072258 GGTGGGAAGTGAAACCAGCAAGG + Intergenic
928849076 2:35720537-35720559 GCAGGGAAATGATAACTGGAGGG - Intergenic
930819537 2:55631811-55631833 GGTGGGAAGTGATACTAGACAGG + Intergenic
936632198 2:114215662-114215684 GGTGGGAACTGAAGCCTGAGAGG + Intergenic
937242168 2:120468924-120468946 GGTGAGAAAAGACACCTGGAAGG + Intergenic
938381804 2:130840525-130840547 GGTGGGAAAGACTACCTGGATGG - Intronic
940459074 2:153939352-153939374 GGTAGGAAATGAGATCAGAAAGG + Intronic
940748018 2:157592628-157592650 GGTGGGAAATGAAATATGAGAGG - Intronic
941299522 2:163784084-163784106 GGTGGAACATGATAACTGAGAGG + Intergenic
943644134 2:190390102-190390124 GCTGGGAATTGGTATCTGAAAGG - Intergenic
943778798 2:191798235-191798257 AGTGGGAGATGCTATCTGAATGG + Intergenic
948936742 2:241170448-241170470 GTTGGGAAATGATCCCCGAGTGG + Intronic
1171934574 20:31261756-31261778 GTTGAGAATTGATTCCTGAAAGG - Intergenic
1172837867 20:37884666-37884688 GGTGTGAGCTGAGACCTGAACGG + Intergenic
1174805247 20:53599476-53599498 GGTGGCAAATCATACCGGGATGG + Intronic
1175242062 20:57557009-57557031 GGTGCAAAATGACACCTGAGAGG + Intergenic
1177001962 21:15624139-15624161 GGTGGGAAATGAAGCGAGAAAGG - Intergenic
1179837566 21:44047005-44047027 GGTGGGAAAGGACTCCAGAAAGG - Intronic
1183768877 22:39906082-39906104 GGGGGGAAAAAATCCCTGAAAGG + Intronic
949811663 3:8012915-8012937 GGATGGAAGTGACACCTGAAGGG - Intergenic
951027892 3:17848850-17848872 GCTGGAAAAAGAAACCTGAAGGG + Intronic
951172617 3:19559442-19559464 GGTGGGAAATGAAAGGAGAAAGG + Intergenic
952774178 3:37028817-37028839 GGTGGAAGATGATTCCCGAAAGG + Exonic
953558510 3:43966011-43966033 CCTGGGATATGAGACCTGAATGG - Intergenic
955052796 3:55429028-55429050 GGTTGGAAATTATACTGGAAAGG + Intergenic
955910930 3:63859543-63859565 GGAGGGCAGTGATACCTGACAGG - Intronic
957450340 3:80373170-80373192 GGTGGGAAATCATTGCAGAAAGG + Intergenic
957559512 3:81803889-81803911 AGTAGGAATTGATACCTGATTGG - Intergenic
958755653 3:98246912-98246934 GATGGTAAGTGATACCTGATTGG - Intergenic
959316092 3:104808972-104808994 GGTAGAAAATGGTACCTAAATGG + Intergenic
960401463 3:117204485-117204507 GTGGTGAAATAATACCTGAAAGG + Intergenic
961742563 3:129041959-129041981 GGTGGGACAGGATGGCTGAAGGG - Intergenic
961772418 3:129259746-129259768 GGAGGGATATGGTACCCGAATGG + Intronic
962560882 3:136605537-136605559 GGAGGGGAAAGATAACTGAAAGG - Intronic
967094628 3:186167046-186167068 TGTGGGAAGTGATAGCTGCAAGG - Intronic
968005775 3:195241714-195241736 CGTTTGAACTGATACCTGAATGG - Intronic
970201410 4:13611842-13611864 GGTGGGAATTAATAACTGGAAGG + Intronic
971142691 4:23941751-23941773 CCAGGGAAATCATACCTGAAAGG - Intergenic
972696139 4:41448712-41448734 GTTGGGAAATGATAACTAAAGGG - Intronic
973680959 4:53319449-53319471 GATTGGAAATAATACCTGTAAGG - Intronic
978307464 4:107347212-107347234 GGTGGGAGACAATCCCTGAAAGG - Intergenic
978433704 4:108660316-108660338 GATGAGAAATGATATCAGAAAGG - Intronic
978540093 4:109807189-109807211 GGTGGGATATGAGGCCTCAAGGG - Intergenic
979781150 4:124652432-124652454 GGTGAGTAAAGATAACTGAATGG + Intergenic
981621406 4:146703721-146703743 GGTGGAAAATGATATCTTATTGG + Intergenic
984148909 4:176101217-176101239 GGTGGGACAGGATGGCTGAAGGG - Intronic
989664921 5:43842728-43842750 GGTGGGACATGATAACCAAAGGG + Intergenic
993314385 5:86382037-86382059 GGATGGAAATAATAACTGAATGG + Intergenic
993991598 5:94664681-94664703 GGTCTCAAATGTTACCTGAAAGG - Intronic
994523698 5:100876366-100876388 GGTGAGAAATGGTACATAAATGG + Intronic
995313167 5:110736817-110736839 GATAGGAAATGAGAGCTGAAAGG - Intronic
995967977 5:117932266-117932288 TGTGGAAACTGAGACCTGAATGG - Intergenic
997415991 5:133729106-133729128 GGTGGGGAAAGGTTCCTGAAAGG + Intergenic
999535970 5:152517955-152517977 GGTTAGAAATGATACAGGAAGGG - Intergenic
1002009632 5:176267446-176267468 GAAGGGAAATGACACCTAAATGG + Intronic
1002217089 5:177644843-177644865 GAAGGGAAATGACACCTAAATGG - Intergenic
1002251180 5:177930392-177930414 TGTGGGAAATGAGACCGGCATGG + Intergenic
1002295955 5:178231626-178231648 GGGGGGAAATGAGAGCTGGAAGG + Intronic
1002366786 5:178719076-178719098 AGTGGGAAATAATACTGGAAAGG - Intronic
1002805916 6:573763-573785 GTTAGAAAATGACACCTGAAAGG + Intronic
1003006256 6:2384717-2384739 GCTGGGAAATGGTACCCGCAGGG + Intergenic
1004950640 6:20667379-20667401 TGTTGACAATGATACCTGAATGG + Intronic
1006587518 6:35126581-35126603 GGTGAGCAACAATACCTGAAAGG + Intronic
1007848238 6:44778895-44778917 GGTGAGAAATGGTATCTCAATGG + Intergenic
1011145714 6:84213926-84213948 GGTCGGAAATGTTACCCAAATGG - Intronic
1018157588 6:161001993-161002015 GGGGGGAAATGTTTCTTGAATGG - Intronic
1019811373 7:3167551-3167573 GGAGGGAAGAGATACCAGAAAGG - Intronic
1021773452 7:24028194-24028216 GGTGGGAAATGGTACAGGGAGGG + Intergenic
1021958088 7:25846461-25846483 GGTGGTAAATGACTCCAGAATGG - Intergenic
1022196412 7:28071606-28071628 GGTGGCAAATGGTAAGTGAAAGG - Intronic
1022420400 7:30215430-30215452 GGTGAGAAAGGATGGCTGAAGGG - Intergenic
1022436794 7:30394824-30394846 GGTGGAAAGTGACACATGAAGGG - Intronic
1023477601 7:40597916-40597938 GGAGGCAGATGATATCTGAAGGG - Intronic
1025613404 7:63097589-63097611 AGTGGGAAATGATGCTTTAATGG - Intergenic
1028363267 7:89994791-89994813 GGTGGGACATGATCCCAGAGAGG - Intergenic
1028865309 7:95704038-95704060 GGAGGGAAAAGAGACCTAAATGG - Intergenic
1029715720 7:102324424-102324446 GGTGGGATATGAGACCTGCAAGG + Intergenic
1030174738 7:106640421-106640443 TGTGTGTAATGTTACCTGAAAGG - Intergenic
1030849931 7:114471365-114471387 GGTGGGAAATGATACCTGAATGG - Intronic
1031219016 7:118939760-118939782 GGTGTTAAATGATACTAGAAGGG + Intergenic
1032517614 7:132518775-132518797 GCTGGGACATGATCTCTGAATGG - Intronic
1033240228 7:139672979-139673001 GGTGGTAAATGTTACCTTATGGG - Intronic
1033870576 7:145749975-145749997 GGGGGGAAATGATACTGGAGAGG - Intergenic
1039972522 8:42332465-42332487 AGTGGGAAATAACACCCGAAAGG + Intronic
1040506715 8:48055701-48055723 GATGGGAAATGACAACTGATGGG - Intronic
1042730347 8:71926794-71926816 GGTGGGAAAGACTATCTGAATGG + Intronic
1043952498 8:86325246-86325268 GGTGGGAAAAGATTCCAGCAAGG - Intergenic
1044427800 8:92073345-92073367 GGTGGGAAATGATACTAAAGGGG - Intronic
1045553910 8:103196726-103196748 GGTGGGAAATAATACCAGGGAGG - Intronic
1047040845 8:120993513-120993535 GTTGGGAAATGATACAGGAAAGG + Intergenic
1048960214 8:139570285-139570307 GGTGGGATATGTTATCTCAAGGG + Intergenic
1048960638 8:139573878-139573900 GGAGGGGAATGGTACCTGTAAGG + Intergenic
1049480899 8:142822049-142822071 GGTGGGAAATGGCTCCTGCACGG + Intergenic
1051441586 9:17089146-17089168 GTAGGGAAATTATCCCTGAATGG - Intergenic
1057632495 9:96731838-96731860 GGAGGCAAAGGATACCTTAATGG - Intergenic
1057814591 9:98285230-98285252 GGTGGGTAAGGATACCCAAAGGG - Intergenic
1187733701 X:22282592-22282614 GGTGGGAAATGAAGCCAGAGAGG - Intergenic
1189372324 X:40438605-40438627 GGTGGGAATTGTTACCATAATGG + Intergenic
1190318492 X:49165848-49165870 TGTGGGAAATGATTTCTGAGGGG + Intronic
1190755219 X:53395656-53395678 GATGGGAAATGTTAACTGAGAGG - Intronic
1192558468 X:72108993-72109015 GGTGGAAAAGGATGACTGAAAGG - Intergenic
1194074879 X:89377956-89377978 GGTGGGACATGCTACGTGACTGG - Intergenic
1196264540 X:113626697-113626719 GAGGGGAAATGATCACTGAAGGG + Intergenic
1196976301 X:121161422-121161444 GGTGGGAATTGATGCCTGCCTGG + Intergenic
1197834319 X:130678434-130678456 GGAGGGAAATGAAATCTGAAAGG - Intronic
1198121131 X:133593487-133593509 GGTGGGAAATGAAGCCAGAAGGG + Intronic
1198131049 X:133695267-133695289 GTTGGGGAATGATAGCTAAAGGG + Intronic
1199883114 X:151992105-151992127 GGTGGTAAGTGATAGCTAAAGGG + Intergenic
1200730477 Y:6732120-6732142 GGTGGGACATGCTACGTGACTGG - Intergenic