ID: 1030855816

View in Genome Browser
Species Human (GRCh38)
Location 7:114555933-114555955
Sequence GAGGGAGGTATAGAAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 409}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030855816_1030855819 -7 Left 1030855816 7:114555933-114555955 CCCTTGTCTTCTATACCTCCCTC 0: 1
1: 0
2: 2
3: 57
4: 409
Right 1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG No data
1030855816_1030855826 22 Left 1030855816 7:114555933-114555955 CCCTTGTCTTCTATACCTCCCTC 0: 1
1: 0
2: 2
3: 57
4: 409
Right 1030855826 7:114555978-114556000 TGCTGACATGGCAGTGGACTTGG No data
1030855816_1030855823 10 Left 1030855816 7:114555933-114555955 CCCTTGTCTTCTATACCTCCCTC 0: 1
1: 0
2: 2
3: 57
4: 409
Right 1030855823 7:114555966-114555988 GTCAGGAACCACTGCTGACATGG No data
1030855816_1030855824 16 Left 1030855816 7:114555933-114555955 CCCTTGTCTTCTATACCTCCCTC 0: 1
1: 0
2: 2
3: 57
4: 409
Right 1030855824 7:114555972-114555994 AACCACTGCTGACATGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030855816 Original CRISPR GAGGGAGGTATAGAAGACAA GGG (reversed) Intronic
900863127 1:5246657-5246679 GAGGGAGGGAAGGAAGAAAAAGG - Intergenic
903254524 1:22085304-22085326 TAGGGAGATATATAAGACAATGG - Intronic
904402039 1:30263280-30263302 GAGGAAGGGAGAGAAGAAAAGGG + Intergenic
905366227 1:37453031-37453053 GAGGGAGAAAGAGAAGAGAATGG - Intergenic
906065262 1:42975944-42975966 GTGGAAGGTATGGAAGCCAAGGG + Intergenic
906174865 1:43762381-43762403 GAGGGAAGGATAGAGCACAAAGG - Intronic
906351009 1:45059503-45059525 GAGGGAGACATAGAGGACAAGGG + Intronic
906427788 1:45727462-45727484 GAGGGAGGGAAGGAAGAGAAAGG - Intronic
907353908 1:53856433-53856455 GACAGAGGTAGAGAACACAATGG - Intronic
907358515 1:53895868-53895890 GAGGGGGATATAGACGACGATGG - Intronic
907654728 1:56330985-56331007 GAGTGAAGTATTGAATACAAGGG + Intergenic
908150224 1:61293149-61293171 GAGGGAGGAAGAGAGGGCAATGG - Intronic
909460803 1:75911205-75911227 AAGGGAGGTGTAGAAAACAAAGG - Intronic
909487234 1:76187870-76187892 GAGGGAGGTATAGAGGCTCAAGG - Intronic
909895522 1:81064493-81064515 GAGGAAGAAATAGAAGACACAGG - Intergenic
910623523 1:89282563-89282585 GATGGAGGAATAGAAGCAAAAGG + Intergenic
911375961 1:97051909-97051931 GAGAGGGGAAAAGAAGACAATGG + Intergenic
911701615 1:100959672-100959694 GAGGAGGGTATACAAGACAGAGG + Intronic
912559774 1:110542201-110542223 GAGAGAGGTAGAAAATACAAAGG - Intergenic
912710872 1:111948816-111948838 GAGGGAGGGATAGGCGAGAAGGG + Intronic
913702670 1:121387627-121387649 GTGGCAGGTAAAGAAGACAATGG + Exonic
913966262 1:143380000-143380022 GAGGGATGGAGAGAAGAAAAAGG + Intergenic
914043233 1:144068122-144068144 GTGGCAGGTAAAGAAGACAATGG + Intergenic
914060636 1:144205607-144205629 GAGGGATGGAGAGAAGAAAAAGG + Intergenic
914118514 1:144760762-144760784 GAGGGATGGAGAGAAGAAAAAGG - Intergenic
914134853 1:144892366-144892388 GTGGCAGGTAAAGAAGACAATGG - Exonic
914250993 1:145921247-145921269 AAAGGAGCTAAAGAAGACAATGG + Intergenic
915592832 1:156880316-156880338 AAGGGAGGAAGAGAAGAAAAGGG - Intronic
915795355 1:158726077-158726099 GAGAGAGATTTAGAACACAAAGG + Intergenic
916490963 1:165302109-165302131 GAGGGAGGGAAAGCAGAAAAGGG - Intronic
916671530 1:167026177-167026199 GAGGGAGGTAGAGAACAAGATGG + Intergenic
916816295 1:168356555-168356577 GAGGGAGGGAAAGAAAAGAAAGG - Intergenic
917236504 1:172898300-172898322 GAGGCAGGAATAGAACAGAATGG - Intergenic
917725897 1:177826779-177826801 TAGAGAGGGAAAGAAGACAATGG - Intergenic
918046146 1:180942080-180942102 GAGGGAGGCATAGGAGAAATGGG - Intronic
919211102 1:194487847-194487869 GAGGGAGGGAAGGAAGACCATGG - Intergenic
920070769 1:203301462-203301484 GAGGGAGGTAGAGAAGAATGAGG + Intergenic
920490101 1:206406370-206406392 GTGGCAGGTAAAGAAGACAATGG + Exonic
921184102 1:212655535-212655557 GAGGGAGGTGGAGGAGACAGAGG + Intergenic
921720851 1:218469470-218469492 GAAGCAGGTATTGAAGGCAAAGG + Intergenic
924120932 1:240797276-240797298 GAGGGACAGATAGAAAACAAAGG - Intronic
924226174 1:241923400-241923422 GAGCGAGTGACAGAAGACAAAGG + Intergenic
924290346 1:242529822-242529844 GAGGGAGGGAGAGAAGAAGAAGG - Intergenic
924366132 1:243295801-243295823 GGGGGAGGCATAAAAGAGAAAGG - Intronic
1063096736 10:2915384-2915406 GAGTGAGGCAGAGAAGACCAGGG - Intergenic
1063525268 10:6778914-6778936 GAGGGAGGGAAAGAAGGAAATGG + Intergenic
1064144955 10:12819926-12819948 GAGTGAGGTAAGGAAGAGAAGGG + Intronic
1064909897 10:20388920-20388942 GAGGAAGGAAGAGAAGATAAAGG + Intergenic
1065298094 10:24295740-24295762 TAGGGAGGTATAGAAGGGAGAGG - Intronic
1066051777 10:31643191-31643213 GAGGGAGGTTGTGAAGACCAGGG - Intergenic
1067427735 10:46222225-46222247 CAGGGAGGTAGAGAAGGCAGAGG - Intergenic
1067433126 10:46257083-46257105 CAGGGAGGTAAAGAAGACAAAGG - Intergenic
1067440146 10:46304357-46304379 CAGGGAGGTAAAGAAGACATAGG + Intronic
1067571690 10:47376467-47376489 GAGGGAGGTATGGGAGAATAAGG + Intronic
1067583152 10:47458114-47458136 CAGGGAGGTAGAGAAGGCAGAGG - Intergenic
1067675999 10:48377579-48377601 GAGGGGTGGAAAGAAGACAAGGG - Intronic
1067750462 10:48968151-48968173 GTGTAAGGTATGGAAGACAATGG + Intronic
1068571889 10:58638904-58638926 GAGGGAGGGAGGGAAGAAAAAGG - Intronic
1068887262 10:62110445-62110467 GAGGGAGGAAAAGCAGAAAAAGG - Intergenic
1068968796 10:62940717-62940739 CAGGGAGGCACAGAAGAAAAAGG - Intergenic
1071364427 10:84884178-84884200 GACAGAGGGAAAGAAGACAAAGG - Intergenic
1071947048 10:90657380-90657402 GAGAGAGGAAGAGAAGACTAGGG - Intergenic
1073354259 10:102841304-102841326 GAAGGAGGAATAGAAGAATAAGG + Intergenic
1073592304 10:104768892-104768914 GAGGGAGGTACAGAGGGCAGGGG + Intronic
1073805553 10:107093825-107093847 GAAGGAGGTAGAGAACAGAAAGG - Intronic
1074090297 10:110246678-110246700 GAGGCATGTATAGGAGACAATGG + Intronic
1074232394 10:111550424-111550446 GAAGGAGATAAAGAAGACAAAGG + Intergenic
1074401732 10:113146988-113147010 GAGGGAGGAAAAGAAGAACATGG - Intronic
1077784317 11:5366221-5366243 TAGGAAAGTATAGAAGACAAAGG + Intronic
1077842346 11:5989220-5989242 GAGGTAGGCAAAAAAGACAATGG - Intergenic
1077936876 11:6797454-6797476 GAGGTAGGTATTGAGGAGAAAGG - Intergenic
1078921450 11:15834819-15834841 GCGGGAGTTAAAGAAGGCAAAGG - Intergenic
1079085594 11:17442724-17442746 GATGGAGGTATAGATGGCAAAGG + Exonic
1079849704 11:25516072-25516094 GAGGGATGTCTAGACGCCAAGGG - Intergenic
1080064818 11:27999384-27999406 CAGGGAGGTAAAAAAGACAACGG - Intergenic
1081591772 11:44428011-44428033 GAGGGAGGTCCAGAGGACGAGGG + Intergenic
1082116194 11:48331059-48331081 GAGGGAAATAGAGAAGAAAAGGG - Intergenic
1082257544 11:50048903-50048925 GAGGGAAATAGAGAAGAAAAGGG + Intergenic
1084088360 11:66865067-66865089 GAGGGAGGCAGAGAAGTCAGGGG + Intronic
1084378383 11:68794275-68794297 GTGGGAGGGAGAGATGACAAAGG + Intronic
1084527509 11:69705958-69705980 GAGGGAGGAATAGAATACTGTGG - Intergenic
1085082958 11:73648891-73648913 GAGGGAGGGTTAGTAAACAAGGG - Intronic
1085108516 11:73866922-73866944 GAGGGAGGTCCAGAAGGAAATGG + Intergenic
1085544416 11:77303660-77303682 GAGGGATATATAGAACACACAGG - Intergenic
1087249179 11:95876809-95876831 GAGAGAGGGAGAGAAGAGAAAGG - Intronic
1087622726 11:100560817-100560839 GAGGGCAGTATAAGAGACAAGGG + Intergenic
1088056749 11:105590614-105590636 AAGGGACTTATAGAATACAAAGG + Intergenic
1088584938 11:111353901-111353923 GAGGGAGGTAAAGAAGGAAAGGG + Exonic
1088676297 11:112196955-112196977 GAGGGAGGGAAAGAAGGGAAGGG - Intronic
1089029923 11:115315179-115315201 GAGGGAGGAAGAGAAAAAAAAGG + Intronic
1089976691 11:122738412-122738434 GAGGAAGAGATAGAAGACAGAGG + Intronic
1090028171 11:123185259-123185281 GAGGGAGGGAGAGAGGAAAAGGG + Intronic
1091652205 12:2318877-2318899 GAGGGTTGGATAGAAGAGAATGG + Intronic
1091878800 12:3960001-3960023 GAGGGAGGTCTTGGAGAGAATGG + Intergenic
1092138951 12:6169527-6169549 GAGGGAGGAAGAGAGGAGAAAGG - Intergenic
1092397038 12:8135880-8135902 GAAGGAGGTATGGAATATAAAGG - Intronic
1094670773 12:32566741-32566763 GATGGAGGCAGAGAAGAGAAGGG + Intronic
1095655336 12:44661923-44661945 GAGGGAGGGAGAAAAGATAAAGG - Intronic
1096023338 12:48340174-48340196 GACCGAGGTAGAGAAGACAGTGG + Exonic
1096085321 12:48861751-48861773 GAGGGTGGTATTGAAGACTCAGG - Intronic
1096710809 12:53453742-53453764 AAAGGAGGTATTGAAGGCAAAGG + Intronic
1096734118 12:53639538-53639560 GAGGGAGGGAAAGAAGAGGAAGG - Intronic
1096847954 12:54418353-54418375 GAGGGAGGAGTAGGAGACAGAGG + Intronic
1097134518 12:56840632-56840654 TAGGGAGGTATAGATAATAAAGG - Intergenic
1097868972 12:64584410-64584432 GAGGGAGGTATGGAAAACAAGGG - Intergenic
1099278373 12:80608033-80608055 ATGGGAGGAATAGAAGATAAAGG + Intronic
1099370142 12:81818738-81818760 GAGAGAGATAAAGAAGAGAAAGG + Intergenic
1099508613 12:83507517-83507539 GACAGAGGAACAGAAGACAAGGG + Intergenic
1100031449 12:90197199-90197221 GAGGGAGTTTTAGGAGATAATGG + Intergenic
1100200784 12:92295891-92295913 GAGGGAGATACAGAAGACAGAGG + Intergenic
1100535955 12:95509376-95509398 CAGGGAGGTAAGGAAGACAGAGG + Intronic
1100760034 12:97797176-97797198 GAGGGAAGTACAGAGTACAATGG - Intergenic
1100976402 12:100126936-100126958 CAGGAAGGTAAAGAAGAAAAAGG + Intronic
1101059892 12:100959821-100959843 GATGGAGATACAGAAGAAAAGGG - Intronic
1101390049 12:104292158-104292180 GAGTGTACTATAGAAGACAAGGG + Intronic
1102604645 12:114059039-114059061 GAGGAAGGTATTGAGGACAAAGG - Intergenic
1104485435 12:129148093-129148115 GAAGGAGGTAGACAAAACAATGG - Intronic
1104790387 12:131477947-131477969 GATGGAGGTCTGGAAGGCAAAGG - Intergenic
1105740163 13:23315510-23315532 GAGAGAGGAAGAGAAGACTAGGG + Intronic
1107177628 13:37418139-37418161 GAAGGAGATAGAGAAGAAAAAGG - Intergenic
1107745878 13:43507739-43507761 GAGGGAGGTATCTAGGAAAAAGG + Intronic
1108547369 13:51509153-51509175 GAGAAAGCTATGGAAGACAAAGG + Intergenic
1109933257 13:69244856-69244878 GAGAGAGGAATAGAAGACTCAGG - Intergenic
1110255640 13:73430952-73430974 GATGGAGGTTTAGAAGAGACAGG + Intergenic
1110273883 13:73621042-73621064 GAGGGTGGAACAGAAGAAAACGG + Intergenic
1110377820 13:74814326-74814348 GAGGGAGGCCTAGAAGAAAATGG + Intergenic
1110522304 13:76494351-76494373 GAGGGAAGTACAGAAAAGAAAGG + Intergenic
1111057218 13:82967169-82967191 GAGGGAGGCATGGGATACAAAGG + Intergenic
1111329973 13:86752686-86752708 TTGGGAGGTACAGAAGACAAAGG - Intergenic
1111432209 13:88159360-88159382 GAGAAAGGTAAAGAAGACTAGGG - Intergenic
1111632373 13:90858793-90858815 AACAGAGGGATAGAAGACAATGG - Intergenic
1111940678 13:94603311-94603333 GTGGGATGTATAGAAGACGTGGG + Intronic
1112093255 13:96105281-96105303 GAGGGAGGGAGAGAAGGGAAGGG + Intronic
1112251530 13:97785058-97785080 GAGGGAGGAAGAGAGGACAGTGG - Intergenic
1112421619 13:99255777-99255799 GATACAGCTATAGAAGACAAGGG + Exonic
1113337752 13:109393287-109393309 GAGGGTGGTGTGGAAGACAGGGG - Intergenic
1113452924 13:110424803-110424825 CAGGGACGTAAAGGAGACAAGGG + Exonic
1114361072 14:21973464-21973486 ATGGGAGGTATAGAAGACTTAGG - Intergenic
1114422079 14:22592736-22592758 GAGGGAGGGAAACCAGACAAAGG - Intergenic
1114660118 14:24338587-24338609 GTGGGAGGTAGGGAAGACAAGGG + Intronic
1115320627 14:32076713-32076735 GGGGGAGGGGTAGAAGCCAATGG + Intronic
1115548360 14:34483268-34483290 TAGAGAGGTTTAGAAGAAAATGG - Intergenic
1116249098 14:42457958-42457980 GATGGAGGAAGAGAAGACTAGGG + Intergenic
1116509030 14:45720419-45720441 GAAGGAGGTATAGAAGTCACTGG + Intergenic
1116934351 14:50723473-50723495 AAAGGAGGTGTAGAAGTCAATGG + Intronic
1117343487 14:54811037-54811059 AAGGGAGGTAGAGATTACAAAGG + Intergenic
1118171902 14:63396072-63396094 GAGGGAGGAAAAGAGGAGAAGGG + Intronic
1119847425 14:77840868-77840890 GAGGGAGGGAGAGAAGGGAAGGG + Intronic
1119862196 14:77944237-77944259 GAGAGAGAAATAGAAGAAAAAGG - Intergenic
1119983363 14:79107567-79107589 GAGGGAGCTAGAGAGGAAAAGGG + Intronic
1120917495 14:89722742-89722764 GAAGCAGGCATAGAAGCCAAGGG - Intergenic
1121006068 14:90491441-90491463 GAGGGATGTAGAGAAGACAGGGG + Intergenic
1121006203 14:90492073-90492095 CAGGGAGATGCAGAAGACAAAGG + Intergenic
1121630568 14:95418900-95418922 GAGGGAGGAAAAGAAGAGAGGGG - Intronic
1121782846 14:96633368-96633390 GAGGGAAGGAAGGAAGACAAGGG - Intergenic
1122711499 14:103661814-103661836 GAGGGAGGTCTAGGAGAGCAGGG - Intronic
1122758837 14:104005119-104005141 GAGGGAGGGAGAGAAGAGAAGGG - Intronic
1124060126 15:26283776-26283798 GAGGAAGGAATGAAAGACAAAGG + Intergenic
1124609498 15:31198700-31198722 GAGGGAGGGAGAGAGGAAAAAGG - Intergenic
1124791719 15:32733290-32733312 GAGGGTGGGAGAGAAGAAAAGGG + Exonic
1124868670 15:33519115-33519137 GAGGGAGGTCTAGAATGCATGGG + Intronic
1125787477 15:42333639-42333661 GAGGGAAGTATAGCAAGCAATGG - Intronic
1126283656 15:46986607-46986629 GACAGAGGAAAAGAAGACAAGGG + Intergenic
1126341206 15:47642880-47642902 GAGAGAGGTAAAGATGAAAATGG + Intronic
1128766964 15:70257151-70257173 GAGGGAGGACTGGAAGAGAATGG + Intergenic
1128886402 15:71292300-71292322 AAGGGATGCATAGGAGACAATGG - Intronic
1129077742 15:73011763-73011785 GAGTGAAATATAGAAAACAAGGG + Intergenic
1131557351 15:93411476-93411498 GAGAGAGGTGTGGAAGGCAAGGG - Intergenic
1132038091 15:98503078-98503100 GATGGAGGGAGAGAAAACAATGG + Intronic
1132646876 16:1003265-1003287 GAGGGAGCTATAGAGGCCACAGG + Intergenic
1133724018 16:8520864-8520886 GAGGGAGGGAAAGGAGAGAAAGG + Intergenic
1134269743 16:12723195-12723217 GAAGAGGCTATAGAAGACAAAGG - Intronic
1135201468 16:20441208-20441230 GAGGGAGGGAGAGAAAATAATGG + Exonic
1138288901 16:55830862-55830884 GAGGGAGGGAAAGAAAAGAAAGG + Intronic
1138644213 16:58411546-58411568 GAGGGAGGGAAAGAAGAAAAAGG + Intergenic
1138867555 16:60841591-60841613 GAGGAAGGAGTGGAAGACAATGG - Intergenic
1139341318 16:66269945-66269967 GAGGGAGGGAGAGAAGAGGAAGG + Intergenic
1140030595 16:71335144-71335166 GAGGGAGGAAGAGAAGAAAGTGG - Intergenic
1140206679 16:72939126-72939148 AGGGGAAGTATAGAAGACAAAGG + Intronic
1140398741 16:74652253-74652275 GAAGCAGGTATAGCAGATAAGGG + Intronic
1141236334 16:82221131-82221153 AAGGGAAGTATAGAATAAAAGGG - Intergenic
1143946206 17:10594813-10594835 GTGGAAGGTCTAGAAGACCAGGG - Intergenic
1145004629 17:19330384-19330406 TAGGGAGGGATAAAAGAGAAGGG - Intronic
1146627134 17:34443381-34443403 GAGGGAGGAAGAGAGGAGAAGGG - Intergenic
1146773395 17:35589513-35589535 GAGGGAGATATAGGAGAGGAGGG + Intronic
1149179900 17:53922940-53922962 GAGGGATATAGAGAAGAAAATGG + Intergenic
1149435929 17:56633522-56633544 GAGGGAGGAAGAGAAGAAAAAGG + Intergenic
1150056212 17:62019675-62019697 GAGGTCTGTATAGAAGAAAAGGG - Intronic
1151137323 17:71959323-71959345 GAGGGAGGTAGGGAAGACACAGG + Intergenic
1151833701 17:76570025-76570047 GAAGGTGGGAAAGAAGACAAAGG + Intronic
1152542447 17:80983050-80983072 GAGGGAGGTATTTAATACAAAGG - Intergenic
1152647770 17:81477659-81477681 GAAGGGGGCAGAGAAGACAATGG - Intergenic
1153804706 18:8702313-8702335 GAGGGAGGGAAAGAAGGGAAGGG - Intergenic
1154371225 18:13765012-13765034 CATGTAGGCATAGAAGACAAAGG - Intergenic
1155322319 18:24631856-24631878 GAGGTGGGTATTGAAGAAAAGGG - Intergenic
1155370722 18:25097583-25097605 GAGAGAGGAACAGAAGACACAGG + Intronic
1157790306 18:50525257-50525279 GAGGGAGGGACAGAAGACCTTGG - Intergenic
1158162835 18:54505628-54505650 GATGGGGGGATAGAAGACAGTGG + Intergenic
1158816322 18:61101603-61101625 CAGAGTGGTATAGTAGACAATGG - Intergenic
1160867354 19:1261755-1261777 GGGGGAGGTAGAGACGAAAAAGG + Intronic
1161671818 19:5616450-5616472 GAGGAAGGCACAGAAGATAATGG - Exonic
1164459076 19:28432449-28432471 GAGGGAGGTATTGAGGATACGGG + Intergenic
1164612503 19:29642157-29642179 GTGGGTGGTTTAGCAGACAAAGG + Intergenic
1165531712 19:36408316-36408338 GAGGGAGACATAGTAGGCAAAGG - Intronic
1165649503 19:37473368-37473390 GAGAGGGGCAGAGAAGACAAGGG + Intronic
1166546839 19:43639333-43639355 GACTGAGGGATAGAGGACAAGGG + Intronic
1166807595 19:45496667-45496689 GGAGGAGGCATAGGAGACAAAGG - Intronic
1168400397 19:56082685-56082707 GAGGGAATAATAGAAGACAATGG + Intergenic
1168539287 19:57197075-57197097 GACGGAGGAAGAGAAGACTAGGG - Intronic
1202700043 1_KI270712v1_random:157495-157517 GAGGGATGGAGAGAAGAAAAAGG + Intergenic
925225922 2:2184087-2184109 GAGGGAGGGAAAGAAAAGAAGGG + Intronic
925235576 2:2274368-2274390 GAGGGAGGGAGAGAGGACAGTGG + Intronic
925380972 2:3426023-3426045 GAGGAAGGTAAAGATGATAAAGG - Intronic
925392785 2:3509021-3509043 GAGGGAGGGGAAGAAGCCAAGGG + Intronic
925772701 2:7298689-7298711 GACAGAGGAAGAGAAGACAAGGG - Intergenic
926534410 2:14092818-14092840 AAGGGAGGAATAGAAGAGAGGGG + Intergenic
927050426 2:19322588-19322610 CAGGGAGGAATAGTAGATAAAGG + Intergenic
928429864 2:31208384-31208406 GAGGGAGGTTCTGAAGCCAAGGG - Intronic
928753707 2:34499233-34499255 GAGGTAGATAAAGAAGAAAAGGG + Intergenic
928958676 2:36898941-36898963 GAGGGAAGAAGAGAAGAAAATGG + Intronic
929112287 2:38414949-38414971 CAGGGAGGGATAGGAGATAATGG + Intergenic
929550915 2:42891243-42891265 GAGGGTGGAATAGAAGGAAAAGG + Intergenic
929691670 2:44080007-44080029 GAGGGAGGCAAAGAAAGCAAAGG + Intergenic
933112715 2:78424297-78424319 AAAGGAGATATAGAAGAGAAGGG - Intergenic
933177389 2:79190932-79190954 GAGGGAGAGATAGATGACTATGG - Intronic
933576121 2:84070529-84070551 AAAGGAGGAAGAGAAGACAAGGG + Intergenic
933749524 2:85594233-85594255 GAGGGAGGGAGAGAAGACACAGG - Intergenic
934064751 2:88330572-88330594 GAGAGAGGGCTAGAAGTCAAAGG + Intergenic
934170975 2:89540970-89540992 GAGGGATGGAGAGAAGAAAAAGG + Intergenic
934281280 2:91615288-91615310 GAGGGATGGAGAGAAGAAAAAGG + Intergenic
935425058 2:102910999-102911021 GACAGAGGAAAAGAAGACAAGGG - Intergenic
938812404 2:134865732-134865754 AAGGGAGGTCTAGGAGATAAAGG - Intronic
940702924 2:157068919-157068941 GAGGGAGGAAGAAAAGACGAAGG - Intergenic
941125151 2:161576035-161576057 GATGGAGGCATAGCAGACCAGGG - Intronic
942088973 2:172469959-172469981 TAGAGAGGTAAAGAAGAAAATGG + Intronic
943132619 2:183873414-183873436 GAGGGAGATACAGGAGAGAATGG - Intergenic
943384022 2:187180765-187180787 GACAGAGGTAGAGAAGACTAGGG - Intergenic
943458968 2:188145906-188145928 GACAGAGGTAAAGAAGTCAAAGG + Intergenic
943669394 2:190645890-190645912 GAAGGAAGTCTAAAAGACAAAGG - Intergenic
945160162 2:206882318-206882340 GAGAGAGGGATAGAAGCAAAAGG - Intergenic
947551223 2:231048193-231048215 AAGGCAGGCAAAGAAGACAAGGG - Exonic
948004910 2:234600159-234600181 GAGGGAGGCACAGAGGACATGGG - Intergenic
1168813853 20:723351-723373 GAAGGAGGTAGAGAAGATAAAGG - Intergenic
1168974587 20:1954579-1954601 AAGGGAAGTAGAGAAGAAAATGG - Intergenic
1169727896 20:8755791-8755813 CAGGGAGGGAAGGAAGACAAAGG + Intronic
1170446110 20:16429593-16429615 GAGGGAGGTAAGGAACAAAAAGG - Intronic
1173427378 20:42954897-42954919 AAGGGAGGGAAAGAAGAAAAGGG + Intronic
1173457203 20:43212916-43212938 GAGGGAGGGAAGGAAGAAAAGGG + Intergenic
1173920650 20:46742434-46742456 GAGGGAGGAAGAGAGGACAAGGG - Intergenic
1174604101 20:51747998-51748020 GAAGGATAGATAGAAGACAAAGG - Intronic
1175047791 20:56123680-56123702 GAGGGAGGGCAAGAAGAAAATGG + Intergenic
1175283301 20:57819912-57819934 GAAGGAGGGAGAGCAGACAAGGG - Intergenic
1175849754 20:62083497-62083519 GAGGGAGGGAGAGAAGAAGAAGG - Intergenic
1175979951 20:62733633-62733655 GAGGGAGATAGAGAAGAGAGAGG + Intronic
1177186859 21:17806887-17806909 GTGGGAGGTAGAAAAGACAGAGG + Intronic
1177993730 21:28070562-28070584 GAGGGAGGTATTATATACAAAGG - Intergenic
1178060707 21:28850820-28850842 GATAGAGGAAGAGAAGACAAGGG - Intergenic
1178608366 21:34058502-34058524 TGGGGAGGAATAGAAGACAGCGG - Intergenic
1179821160 21:43937869-43937891 GCCTGAGGTATAGAAGGCAATGG - Intronic
1180591100 22:16938039-16938061 GAGGGAGGAAGAGAAGACTAGGG - Intergenic
1182032036 22:27167018-27167040 GCGGGAGGTAAAGGACACAAGGG - Intergenic
1182771970 22:32802430-32802452 GAGGAAGGGCTAGAAGAGAAGGG + Intronic
1182920067 22:34071103-34071125 AAGGGAGGCATTTAAGACAAGGG - Intergenic
1185031158 22:48443675-48443697 GAGGGAGGGAAAGAAGGGAAGGG + Intergenic
949317478 3:2772896-2772918 GAGGGAGGAAGAGAAGAGATAGG + Intronic
949412796 3:3784072-3784094 GAGGGAGGAAAAGGAGAGAAAGG + Intronic
949774053 3:7611504-7611526 CAAGAAGGTATAGAAGACAGAGG + Intronic
949844764 3:8358101-8358123 GGGGGAGGTAAAGCAGAGAACGG + Intergenic
950009346 3:9711830-9711852 GAGGGAGATTTAAAAGACAAGGG - Intronic
952723882 3:36561620-36561642 TAGGGAGGTCTAGAAGAAGAAGG - Intergenic
953293942 3:41694374-41694396 GAGGGAGGTATAGAAAGCTATGG + Intronic
953398287 3:42590274-42590296 GAGTGATGTAGAGAGGACAATGG + Intronic
953674991 3:44994029-44994051 CAGGGAAGCATAGAAGATAAGGG + Intronic
954052020 3:47987425-47987447 GTGGGAGGTCTAGAAGGGAAAGG + Intronic
954744996 3:52782764-52782786 GAGGGAGGTGGAGAAGGCAAAGG - Intronic
955719300 3:61864784-61864806 GAAGGAGGCATGGAAGACCAGGG + Intronic
955928520 3:64031939-64031961 GAGGGAGGTAGGGAGGACCAGGG - Intergenic
956575521 3:70748531-70748553 GAGGGAGACATTGGAGACAAAGG - Intergenic
956800641 3:72754853-72754875 TATGGAGGTTTAGAAAACAAGGG + Intronic
956948348 3:74251100-74251122 TAGGGTGACATAGAAGACAATGG - Intergenic
957501705 3:81066503-81066525 GAGGGAGGAGGAGAGGACAAGGG - Intergenic
958628823 3:96661749-96661771 AAGGGAAATATAAAAGACAATGG - Intergenic
960058702 3:113296709-113296731 GTGGGAGGTAAGGAAGAGAAGGG - Exonic
962252747 3:133847453-133847475 GACTGAGATATAGAAGAGAAAGG - Intronic
963037726 3:141047171-141047193 GAGGGAGAGAGAGAAGCCAATGG + Intergenic
964739408 3:159949800-159949822 GAGGGAGGCAAATCAGACAATGG + Intergenic
964939922 3:162145766-162145788 GAGGGAGGTGTTGTAGACGACGG + Intergenic
965333788 3:167410196-167410218 GAGGTAGGGATGGAAGACAAGGG - Intergenic
966444565 3:179987294-179987316 GAGGGAGGGAGGGAAGAGAAAGG - Intronic
967117193 3:186352648-186352670 GAGGGAGGCAGAGAAGCCAAAGG - Intronic
968228884 3:196992681-196992703 AAGGGAAGTCTAGGAGACAAGGG - Intronic
968827637 4:2911266-2911288 GAGGGAGAAATGGAAGGCAAAGG - Intronic
968957380 4:3726201-3726223 GAGGGAGGGAGAGAGGACAGAGG + Intergenic
969028797 4:4194909-4194931 GAGGGATGGAGAGAAGAAAAAGG - Intronic
969192813 4:5535908-5535930 GAGACAGGTGTAGAAGACAAAGG - Intergenic
970644191 4:18100669-18100691 GAGTGAGGTACAGAAAACCAAGG + Intergenic
971627852 4:28946285-28946307 GAGGGAGGGAGAGGAGCCAATGG + Intergenic
972183381 4:36497251-36497273 GCGGGAGATAGAGAAGAGAAAGG - Intergenic
973155337 4:46944653-46944675 AAGGGAGGTAAAGAAGATGAAGG - Intronic
974927175 4:68314096-68314118 GAGGTCGATATAGAAGATAATGG - Exonic
975554103 4:75642930-75642952 TTAGTAGGTATAGAAGACAATGG - Exonic
975982566 4:80176953-80176975 GACAGAGGAAGAGAAGACAAGGG - Intergenic
976158363 4:82172121-82172143 GAGGGAGGGAGGGAAGAGAAGGG + Intergenic
978071714 4:104480838-104480860 GAGGGAGGGAGGGAAGATAAAGG - Intronic
978173079 4:105697414-105697436 GAGGGGGGAAGAGAAGAAAAAGG + Intronic
979422695 4:120525826-120525848 AAGTGAGGCATAGAAGAGAAGGG + Intergenic
980435712 4:132770409-132770431 GAGGGATGTATAGAGGCCACAGG - Intergenic
980695487 4:136350033-136350055 CATGGAGATATAGAATACAATGG + Intergenic
980998835 4:139808658-139808680 GTGGGAGGGAGAGAACACAAAGG - Intronic
982083815 4:151815124-151815146 GAGGAAGGTATTGAGGACAAAGG + Intergenic
982439695 4:155421491-155421513 GAGAGAGGGAGAGAAGACACAGG - Intergenic
983387416 4:167082809-167082831 GAGGGAGGGAGGGAAGACAGAGG + Intronic
983797847 4:171887434-171887456 GAGAGAAGTATAGAATAAAAAGG + Intronic
984443030 4:179797333-179797355 GAGGGAGGGAGGGAAGGCAAGGG + Intergenic
984504763 4:180603037-180603059 GACAGGGGTAGAGAAGACAATGG + Intergenic
986766408 5:10932114-10932136 GATGAAGGAATGGAAGACAAGGG - Intergenic
987201957 5:15586277-15586299 GAGAGAGAGAAAGAAGACAAGGG - Intronic
987663019 5:20902088-20902110 GAGGGAGGGAGGGAAGACAAAGG + Intergenic
988174008 5:27696813-27696835 GAGGGAGGGATGAAAGAGAAAGG + Intergenic
988537961 5:32085961-32085983 GAGGAAGGTAAGGAAGACAATGG - Intronic
988759667 5:34300095-34300117 GAGGGAGGGAGGGAAGACAAAGG - Intergenic
989278380 5:39614567-39614589 GATGGAGGAATAGAAGGGAAAGG + Intergenic
989331359 5:40262799-40262821 GAGGGAGGGAAAGAAGAGGAAGG + Intergenic
989600202 5:43193339-43193361 GAGGGAGGAGGAGAAGAGAAGGG - Exonic
989764080 5:45058520-45058542 CAGTGAGGTATAGAAAATAATGG + Intergenic
990494499 5:56334246-56334268 GCGGGAGAAAGAGAAGACAAGGG + Intergenic
990769792 5:59230137-59230159 GAGGGAGGGAAAGAATAAAAAGG - Intronic
990948267 5:61271962-61271984 GATAGAGGGATAGAAGAGAATGG - Intergenic
991902632 5:71475950-71475972 GGTGGAGGTAAAGAACACAAAGG - Intronic
993199818 5:84800814-84800836 GAGGGAGGGAAAGGAGAGAAGGG + Intergenic
993666801 5:90708449-90708471 GAAGGAGGAATAGAACACCATGG - Intronic
993717629 5:91291366-91291388 TAGGGAAGGATAGAAGGCAAAGG - Intergenic
994599633 5:101886747-101886769 GAAGGAGGAAAAGAAGAAAAAGG - Intergenic
994768913 5:103956340-103956362 GAGGGAGGAAAAGAAGAGACAGG + Intergenic
994982654 5:106895988-106896010 GAGGCAACTATAGTAGACAAAGG + Intergenic
995303153 5:110609834-110609856 GAGGGAACTATATAAGACTAAGG + Intronic
995306035 5:110651480-110651502 GAGGGAGGGAAAGAACATAAAGG + Intronic
996156315 5:120107160-120107182 GAGGGAGGGAGGGAAAACAAAGG - Intergenic
996217258 5:120884674-120884696 GAAGGACTTCTAGAAGACAATGG + Intergenic
996825610 5:127678167-127678189 GACGGAGGAAGAGAAGACTAGGG + Intergenic
997678637 5:135733878-135733900 GAGGGAGGTATTGAGGATAGAGG + Intergenic
998883275 5:146667122-146667144 TAGGGAGGTGGAGAAGACAATGG + Intronic
999475939 5:151899036-151899058 GAGGGAGGGAGAGAAGAGAATGG + Intronic
1000364877 5:160481454-160481476 GAGGGAGGGAGAGAAGGGAAGGG - Intergenic
1000555324 5:162718531-162718553 GAGGGAGGAAGAGGGGACAAGGG - Intergenic
1000919596 5:167122417-167122439 GAGGGAGGAAGAGAAGGAAAAGG - Intergenic
1001451543 5:171828881-171828903 GAGGAAGTTTTAGAAGACATGGG + Intergenic
1001654109 5:173336347-173336369 GAGGGAGGGAAAGGTGACAAGGG - Intergenic
1001855556 5:175007567-175007589 GAGGGAGGGATGGAGGAAAAGGG - Intergenic
1001951505 5:175819878-175819900 CAGGGAGGAATAGAACAGAAGGG + Intronic
1002557296 5:180052732-180052754 GAGGGAGGAAGAGAATACAAGGG + Intronic
1003492316 6:6634057-6634079 GAGAGAGGTGCAGAAGATAATGG + Intronic
1004264658 6:14138548-14138570 GAAGGGGGTGTAGAAGAGAATGG + Intergenic
1004678385 6:17866753-17866775 AAGGGAGGTATTGAAGAAAATGG + Intronic
1004824249 6:19402907-19402929 GATGGAGGAAGAGAAGACTAGGG - Intergenic
1005366084 6:25078835-25078857 GAGGGAGGAGTAGAAGAAGATGG - Intergenic
1005822364 6:29608326-29608348 GAGGGAGCCATTGAAGGCAAAGG - Intronic
1006270929 6:32967189-32967211 GAGAGTGGTATAGAAGTCAAGGG + Intronic
1007953922 6:45899150-45899172 GAGAAATGGATAGAAGACAATGG + Exonic
1008479296 6:51968387-51968409 GAGGCAGGAAAAGAAGAAAAGGG - Intronic
1008662756 6:53685357-53685379 GAGGCAGGCATGGAAGAAAAGGG - Intergenic
1008833178 6:55794055-55794077 GTGGGAGGTAAAGAAGACGTAGG - Intronic
1009293347 6:61912064-61912086 GAGGGAGAGAGAGCAGACAAGGG + Intronic
1009626558 6:66143952-66143974 GAGAGAGAGAGAGAAGACAAAGG - Intergenic
1009924090 6:70098826-70098848 GAAGGAGGGAAACAAGACAAGGG + Intronic
1010507254 6:76675638-76675660 GAGGGAGGGAGAGAAGGGAAGGG - Intergenic
1010704287 6:79089585-79089607 GAGGGAGGGAGAGAAGAGGAAGG - Intergenic
1010766861 6:79784982-79785004 GAGAAAGGCATAGAAGAGAAAGG + Intergenic
1011011938 6:82712693-82712715 GAGGGCTGTATAAAAGAGAAAGG + Intergenic
1011745356 6:90402963-90402985 GAGGGAGGGAGAGAGGAAAAGGG - Intergenic
1012480672 6:99663657-99663679 GAAGGAGGGATTGAGGACAATGG - Intergenic
1014197869 6:118579739-118579761 TAGGCAGATAGAGAAGACAAGGG + Intronic
1014461290 6:121698784-121698806 GAGGCAAGTCAAGAAGACAAGGG + Intergenic
1014542649 6:122695853-122695875 GAGGGAGGGAGAGAAGAGAGAGG - Intronic
1015562486 6:134531387-134531409 GAGGGAGGAACAGAACAGAATGG - Intergenic
1016580204 6:145620917-145620939 AAGGGAGGTATATGAGATAATGG - Intronic
1017097100 6:150813893-150813915 GAGTGAGGTGGAGCAGACAATGG + Intronic
1017227760 6:152040763-152040785 GACAGAGGAAGAGAAGACAAGGG - Intronic
1017418933 6:154252316-154252338 GAGGGAGGAATACAAGAGAAAGG + Intronic
1017658681 6:156653422-156653444 GAGGAAGGTATGAAAGATAAAGG - Intergenic
1018228584 6:161654697-161654719 GTAGGATGTAGAGAAGACAAAGG + Intronic
1019213756 6:170426675-170426697 CAGGGAAGCAAAGAAGACAAAGG + Intergenic
1019549256 7:1594040-1594062 GAGGGAGGCATAGAGGAGAGAGG - Intergenic
1020545898 7:9529776-9529798 GAGGGAGGAATAGGAGAAAGAGG - Intergenic
1023460739 7:40393622-40393644 GAGGGAGGTGTTGAAGATAGAGG + Intronic
1023550907 7:41369257-41369279 GAGGGAGGGAGGAAAGACAAGGG - Intergenic
1023737518 7:43248065-43248087 GAGGGAGGGAGGGAAAACAATGG + Intronic
1023863076 7:44227024-44227046 GAGGGGGGTGTGGAAGACAGAGG + Intronic
1025614154 7:63103767-63103789 AAGGGAGGTAGAGATGACAAAGG - Intergenic
1026434821 7:70386768-70386790 GAGAGAGGCAGAGAAGACAAGGG - Intronic
1027051645 7:75024926-75024948 GGGGGAGGTAGGGAAGAGAAAGG - Intergenic
1027303753 7:76869986-76870008 GACTGAGGGATTGAAGACAAAGG - Intergenic
1028351031 7:89848384-89848406 GAGTTAGGGACAGAAGACAAAGG + Intergenic
1028476655 7:91261340-91261362 GGGGGAGGTAATGAAGGCAATGG - Intergenic
1029350724 7:100011186-100011208 GAGGGAGGGAAAGAAGGAAAGGG - Intergenic
1030583842 7:111392444-111392466 GAGGGAGGTAAAGAAGTAATAGG - Intronic
1030855816 7:114555933-114555955 GAGGGAGGTATAGAAGACAAGGG - Intronic
1031363569 7:120876262-120876284 GAGGGAGGTGGAAAAGACCATGG - Intergenic
1031720227 7:125166016-125166038 GAGGTGAGTATAAAAGACAAAGG - Intergenic
1032152382 7:129440498-129440520 GATGGAGGTAGAGGAGACAAAGG - Intronic
1032214293 7:129945113-129945135 GAGGGAGGGAAAGATTACAAAGG + Intronic
1032375574 7:131413156-131413178 GAGGGAAGGAAAGAAGAAAAGGG + Intronic
1033861815 7:145637708-145637730 GAGAGAAGAATAAAAGACAAAGG - Intergenic
1034838209 7:154372005-154372027 GAGGGATGTAAAGAGGAGAAAGG + Intronic
1037462809 8:19130371-19130393 GAGGAAGCTATAAAAGCCAATGG - Intergenic
1037493065 8:19413638-19413660 AAGGGAGGTAGAGAGGTCAAGGG + Intronic
1037658486 8:20907443-20907465 GAGGGAGGAAAAGGAAACAATGG - Intergenic
1038129227 8:24710693-24710715 GAGGGAGGGAAAGAGGAGAAAGG + Intergenic
1038679331 8:29652421-29652443 GAGGGAGGAAGAGAAGAAAGAGG + Intergenic
1039312877 8:36337909-36337931 GAGGGATGAATAGAACACATAGG + Intergenic
1039700866 8:39960428-39960450 GAGGGAGAGATTGAAGACAAAGG - Intronic
1039836533 8:41260626-41260648 GCAGGAGGTATAAAAGACCAAGG - Intergenic
1042127962 8:65558057-65558079 GAGCGAGGGATAGAAGGGAAGGG - Intergenic
1042154966 8:65834681-65834703 GAGGGAGATGGAGAAGACCAAGG - Intronic
1043495576 8:80796947-80796969 GAGGGAGGGAGAGAAGGAAAGGG + Intronic
1045226542 8:100252264-100252286 GAAGGAGGCAGAGAAGAGAAGGG + Intronic
1046587253 8:116162654-116162676 GATGGAGGAAGAGAAGCCAATGG - Intergenic
1049065677 8:140311900-140311922 GAGGGAGGAAAAGAGGACACAGG + Intronic
1049790270 8:144469239-144469261 CAGGGATGTACAGAAGGCAAGGG - Intronic
1050298070 9:4227180-4227202 GAGGGAGGAAGAGAAAACTAGGG - Intronic
1050332944 9:4563596-4563618 GAGGGAAGTGAAGAAGAAAAAGG - Intronic
1050606450 9:7306225-7306247 GAAGGAAGTTTAAAAGACAATGG - Intergenic
1051702931 9:19843662-19843684 GAGGGATGGATGGGAGACAAGGG - Intergenic
1051788873 9:20776887-20776909 GAGGAAGGTATAGCAAAGAATGG + Intronic
1052127682 9:24798111-24798133 GAAGGAGGTATTAAGGACAAGGG - Intergenic
1052368700 9:27641163-27641185 GACGGAGGAAGAGAAGACTAGGG + Intergenic
1052456526 9:28706189-28706211 GAGGAAGGCAGACAAGACAATGG - Intergenic
1052836661 9:33255202-33255224 GAGTGAGGTGTAGCAGAAAAAGG - Exonic
1053113027 9:35478923-35478945 GAGGTTGGGGTAGAAGACAAGGG - Intergenic
1055322983 9:75100333-75100355 GAGGGAGGAAATGGAGACAATGG - Intronic
1055872285 9:80896664-80896686 GAGGGAGGTTCAGAAGAGTAGGG - Intergenic
1056132039 9:83596857-83596879 AAGGGAGATAAAGAAGCCAAAGG + Intergenic
1056311189 9:85342439-85342461 GAGGGAACTATAGAACAAAAGGG + Intergenic
1056904813 9:90636334-90636356 GAGGTAGGGATGGAAGCCAAGGG + Intronic
1058950756 9:109901721-109901743 GCAGGAGGTAGAGAAGTCAAGGG + Intronic
1059013471 9:110488375-110488397 GAGAGAGATAGAGAAGACCAGGG + Intronic
1059483231 9:114608409-114608431 CAGGGAGGCACAGAAGACAGGGG - Intergenic
1059788782 9:117617025-117617047 CAGGCAGGTATAAAAGACTAAGG - Intergenic
1060451693 9:123748659-123748681 GTGGGAGGTAGAAAAGAAAATGG - Intronic
1185603511 X:1354692-1354714 GGGGGAGGAAGAGAAGAAAATGG + Intronic
1185875135 X:3695914-3695936 GAGAGAGCTACAGAAGACAGCGG - Intronic
1186434399 X:9530827-9530849 GAGGGAGGAATTAAAGTCAATGG - Intronic
1187604914 X:20872189-20872211 GACAGAGGAAGAGAAGACAAGGG + Intergenic
1187661836 X:21556076-21556098 GAGGGAGGAAAAGAAGGAAATGG + Intronic
1187865908 X:23723205-23723227 CAGGGTGGTATAGGAGTCAAGGG - Intronic
1188463221 X:30451613-30451635 GAGGGAGGTATTGAGGATAGGGG + Intergenic
1189171773 X:38916381-38916403 GAGGGTGATATAGAGGAGAATGG + Intergenic
1189209011 X:39267035-39267057 GATTGAGGGATAGAAGCCAATGG - Intergenic
1189483145 X:41408475-41408497 GAGGGAGTTCTAGAAAATAATGG - Intergenic
1189630895 X:42952195-42952217 GAAGGAGGAATAGAAGAAAATGG + Intergenic
1192561834 X:72132292-72132314 GAGGGAGGCAAAGAAGAAAGAGG + Intergenic
1192873653 X:75207627-75207649 ATGGGAGGTATAGAAGAGATTGG + Intergenic
1193085274 X:77443336-77443358 GAGGCAGGAACAAAAGACAATGG + Intergenic
1193850878 X:86536092-86536114 GAGAGAGGGAGAGAAGACACAGG + Intronic
1194017515 X:88642207-88642229 TAGGGAGGTATTGAATATAATGG - Intergenic
1194064367 X:89243282-89243304 GAGGAAGGTAGAGAAGGCAAAGG - Intergenic
1194223243 X:91222894-91222916 GAGGGAGGGAGGGAAGACAAAGG + Intergenic
1194343359 X:92731409-92731431 GACAGAGGAAGAGAAGACAAGGG + Intergenic
1195251639 X:103053410-103053432 TAGGTAGGTATAGATGACACTGG - Intergenic
1195275138 X:103274463-103274485 GAGGGAAGTACAGAAGATGAAGG - Exonic
1195681043 X:107546902-107546924 GAAGAAGGTATAGAGGACACAGG + Intronic
1196178581 X:112666453-112666475 CAGGGAGGGATAGAAGAAAAGGG + Intronic
1197240938 X:124122709-124122731 GAGGGTGGTGTTGAAGAAAAAGG + Intronic
1198567300 X:137917366-137917388 GATGAAGGAATAGAAGAAAAAGG - Intergenic
1199022894 X:142903303-142903325 GAGAGATGTATATAAGCCAAAGG + Intergenic
1200559714 Y:4686282-4686304 GAGGGAGGGAGGGAAGACAAAGG + Intergenic
1200651714 Y:5848074-5848096 GACAGAGGAAGAGAAGACAAGGG + Intergenic
1200718542 Y:6577357-6577379 GAGGAAGGTAGAGAAGGTAAAGG - Intergenic
1200936426 Y:8742323-8742345 GAGGGAGGCAGTGAAGATAAGGG - Intergenic