ID: 1030855817

View in Genome Browser
Species Human (GRCh38)
Location 7:114555934-114555956
Sequence TGAGGGAGGTATAGAAGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030855817_1030855823 9 Left 1030855817 7:114555934-114555956 CCTTGTCTTCTATACCTCCCTCA 0: 1
1: 0
2: 3
3: 29
4: 369
Right 1030855823 7:114555966-114555988 GTCAGGAACCACTGCTGACATGG No data
1030855817_1030855826 21 Left 1030855817 7:114555934-114555956 CCTTGTCTTCTATACCTCCCTCA 0: 1
1: 0
2: 3
3: 29
4: 369
Right 1030855826 7:114555978-114556000 TGCTGACATGGCAGTGGACTTGG No data
1030855817_1030855824 15 Left 1030855817 7:114555934-114555956 CCTTGTCTTCTATACCTCCCTCA 0: 1
1: 0
2: 3
3: 29
4: 369
Right 1030855824 7:114555972-114555994 AACCACTGCTGACATGGCAGTGG No data
1030855817_1030855819 -8 Left 1030855817 7:114555934-114555956 CCTTGTCTTCTATACCTCCCTCA 0: 1
1: 0
2: 3
3: 29
4: 369
Right 1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030855817 Original CRISPR TGAGGGAGGTATAGAAGACA AGG (reversed) Intronic
900084997 1:888634-888656 GGAGGGAGGGAAAGGAGACAGGG + Intergenic
900882941 1:5394814-5394836 GGAGGGAGATATAAAAGAAAGGG + Intergenic
902181905 1:14695810-14695832 GGAGAGTGGTATAGAAGACAGGG - Intronic
904624292 1:31793431-31793453 AGAGGGAGGGACAGAAGACAGGG + Intronic
905409028 1:37755634-37755656 TGAGGTAGGTATTCAACACAAGG - Intronic
906065261 1:42975943-42975965 TGTGGAAGGTATGGAAGCCAAGG + Intergenic
906351008 1:45059502-45059524 GGAGGGAGACATAGAGGACAAGG + Intronic
907654727 1:56330984-56331006 TGAGTGAAGTATTGAATACAAGG + Intergenic
909046830 1:70720617-70720639 GGAGGGAGGGAGGGAAGACAGGG - Intergenic
909152739 1:72028877-72028899 TGAGTTAGGGATATAAGACATGG - Intronic
909679629 1:78277486-78277508 GGAGGGAAGTAAAGAAGGCAGGG - Intergenic
912710871 1:111948815-111948837 TGAGGGAGGGATAGGCGAGAAGG + Intronic
912858429 1:113192159-113192181 AGAGGAAGGTAGAGATGACAAGG + Intergenic
912952023 1:114126814-114126836 AGAGGGAGGGAGGGAAGACAGGG + Intronic
913560111 1:120009744-120009766 AGAGGGAGTCATAGAAGCCAAGG - Intronic
913638014 1:120783819-120783841 AGAGGGAGTCATAGAAGCCAAGG + Intergenic
914280696 1:146169163-146169185 AGAGGGAGGCATAGAAGCCAAGG - Intronic
914541739 1:148620103-148620125 AGAGGGAGGCATAGAAGCCAAGG - Intronic
914624900 1:149451144-149451166 AGAGGGAGTCATAGAAGCCAAGG + Intergenic
915309063 1:154998256-154998278 GGAGGGAGGTGAAGGAGACAGGG + Intergenic
915519005 1:156430560-156430582 TGAGGGAGGTGGTGAAGAGAGGG - Intronic
915592833 1:156880317-156880339 TAAGGGAGGAAGAGAAGAAAAGG - Intronic
915826363 1:159082225-159082247 TCAGCTAGGTATAGAAGACGAGG - Intronic
915937017 1:160095595-160095617 TGAGGAAGGAATGGCAGACATGG - Intronic
918046147 1:180942081-180942103 GGAGGGAGGCATAGGAGAAATGG - Intronic
918216503 1:182396239-182396261 TGAGGGAGGTGCAGAGGACAGGG + Intergenic
919549984 1:198973542-198973564 AGATGGGGGTATAGAAGGCATGG + Intergenic
921808518 1:219483748-219483770 TGAGGGAGGAAGAAAGGACAGGG + Intergenic
922450894 1:225736439-225736461 TGAGGGAAATTAAGAAGACAGGG - Intergenic
924010994 1:239665205-239665227 TGAATGAGTTAAAGAAGACAGGG - Intronic
924180820 1:241437169-241437191 GGAGGGAGGTATTGAGGATAGGG - Intergenic
924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG + Intergenic
924362168 1:243254165-243254187 TGAGGAATGTAAGGAAGACAGGG - Intronic
924463014 1:244275986-244276008 TGAGGGAGAAATAGCAGTCAGGG + Intergenic
924463026 1:244276094-244276116 TGAGGGAGAAATAGCAGTCAGGG + Intergenic
1062846039 10:706354-706376 TGAGGGAGGTACACATGACAAGG - Intergenic
1063441830 10:6079058-6079080 TGTGAGTGGTATAGAAGACTTGG - Intergenic
1063522492 10:6753544-6753566 AGAGGGAGGGAGAGAAGAAAAGG - Intergenic
1064011385 10:11739301-11739323 TGCAGGAGGTGTAGAAGATAGGG + Intergenic
1064288861 10:14015164-14015186 GGAGGGAGGGACAGAAGAAAAGG - Intronic
1064576171 10:16748367-16748389 AGAGGTAGGAGTAGAAGACATGG - Intronic
1065383849 10:25115165-25115187 GGAGGGAGGTAGAGAAGGGAGGG - Intergenic
1065383880 10:25115246-25115268 GGAGGGAGGTAGAGAAGGGAGGG - Intergenic
1065383911 10:25115327-25115349 GGAGGGAGGTAGAGAAGGGAGGG - Intergenic
1066051778 10:31643192-31643214 TGAGGGAGGTTGTGAAGACCAGG - Intergenic
1067687993 10:48479310-48479332 TGTGGGAGGGATGGTAGACAAGG - Intronic
1068138898 10:52979333-52979355 GGAGGGAGGGATAGAAAACATGG - Intergenic
1069441495 10:68432873-68432895 TAAGGGACAGATAGAAGACAGGG - Intronic
1071947049 10:90657381-90657403 TGAGAGAGGAAGAGAAGACTAGG - Intergenic
1072220098 10:93319453-93319475 TGAGGGAGGTAAAGCAGATGTGG + Intronic
1072426481 10:95334815-95334837 TGAGGAAGGAATAGAAGAGATGG - Intronic
1072817734 10:98526173-98526195 GGCGGAAGGTATAGAAGACTGGG + Intronic
1073102210 10:101012228-101012250 CGAGGGAGGCATAGAGGACCTGG - Intronic
1073592303 10:104768891-104768913 AGAGGGAGGTACAGAGGGCAGGG + Intronic
1074115120 10:110451186-110451208 AGAGGAAGGTGAAGAAGACAAGG + Intergenic
1075921975 10:126221078-126221100 TGAGGTAGATTTAGAAGAGAAGG + Intronic
1077606149 11:3614076-3614098 TGAGGGAGGAATAGGAGATCTGG + Intergenic
1079124461 11:17708879-17708901 AGAGGGAGGTTGAGAAGACACGG + Intergenic
1080872608 11:36250365-36250387 TGAGGGAGGTAAAGAGAAGAGGG - Intergenic
1082905133 11:58299716-58299738 GGAGGGAGGAAGAGAAGAGAGGG - Intergenic
1083229573 11:61307671-61307693 TGAGAGAGGTATGGAATCCAGGG - Intronic
1083272040 11:61577520-61577542 TGAGGGAGGTGCAGAAGTTAGGG - Intronic
1084088359 11:66865066-66865088 GGAGGGAGGCAGAGAAGTCAGGG + Intronic
1084563500 11:69917072-69917094 AGAGGGAGAGATAGAAGAGAGGG - Intergenic
1085045792 11:73352695-73352717 TGAGGGAGATGTGGAAGGCAGGG + Intronic
1085082959 11:73648892-73648914 TGAGGGAGGGTTAGTAAACAAGG - Intronic
1085651022 11:78268805-78268827 TGAAGGAGGAAAAGGAGACAGGG - Intronic
1085976599 11:81662086-81662108 TGAGAGAGGGAAAGAAGAAAAGG - Intergenic
1086167705 11:83798615-83798637 TGAGACAGGTACAGAACACAGGG + Intronic
1087215028 11:95484406-95484428 AGGGGGAGGTAGGGAAGACAGGG - Intergenic
1087622725 11:100560816-100560838 TGAGGGCAGTATAAGAGACAAGG + Intergenic
1087852203 11:103045139-103045161 TTTGGAAGGTATAGAAGCCATGG + Intergenic
1088582933 11:111332722-111332744 GGAGGGAGGTTTGGATGACAGGG - Intergenic
1088584937 11:111353900-111353922 GGAGGGAGGTAAAGAAGGAAAGG + Exonic
1089600672 11:119612686-119612708 TGAGGAAGGGAAAGAAGACTTGG - Intergenic
1091083505 11:132695781-132695803 TGAGGGAGGATCAGCAGACAAGG + Intronic
1092904157 12:13087042-13087064 TGAGGGATGAAGAGAAGGCAGGG + Intronic
1093826235 12:23693064-23693086 TGAGGGAAATATAAAATACAAGG - Intronic
1094670772 12:32566740-32566762 TGATGGAGGCAGAGAAGAGAAGG + Intronic
1097179856 12:57165524-57165546 TGACAGAGGTATAGAGGCCATGG + Intronic
1097868973 12:64584411-64584433 AGAGGGAGGTATGGAAAACAAGG - Intergenic
1098575348 12:72035755-72035777 TGAGGGCAGCATGGAAGACAAGG + Intronic
1099257005 12:80326764-80326786 TGAAGGAGGTATCCAAGAGATGG + Intronic
1099508612 12:83507516-83507538 TGACAGAGGAACAGAAGACAAGG + Intergenic
1099984414 12:89646470-89646492 TGAGGGAGGCAAGGAAGGCAGGG + Intronic
1100893895 12:99158053-99158075 TGAGGAAGGTATAAAAGAGAGGG + Intronic
1101048353 12:100834698-100834720 TGATGGAGGAAAAGATGACATGG + Intronic
1101390048 12:104292157-104292179 TGAGTGTACTATAGAAGACAAGG + Intronic
1103565570 12:121813719-121813741 TGAGGGAGAGAAAGAAGGCAGGG - Intronic
1105740162 13:23315509-23315531 TGAGAGAGGAAGAGAAGACTAGG + Intronic
1107576086 13:41724237-41724259 TGAGGATGGTACAGAAGAAACGG + Intronic
1108774693 13:53751392-53751414 TGAGTGAGGCATTGAAGACAGGG + Intergenic
1108798415 13:54062545-54062567 TGTGTAAGCTATAGAAGACAGGG + Intergenic
1108920041 13:55661742-55661764 TGAGGGAGTTGTAGAGGTCAAGG + Intergenic
1109427615 13:62187196-62187218 TGAGGGAGATAAAGCAGAGAAGG + Intergenic
1109645904 13:65255295-65255317 TGTGAGATGTATAGAAGAGAGGG + Intergenic
1109786192 13:67178105-67178127 TAAGTGAGGTAGAGAAGAAAAGG - Intronic
1111432210 13:88159361-88159383 TGAGAAAGGTAAAGAAGACTAGG - Intergenic
1111884189 13:93998480-93998502 AGAGGGAAGTAAAGAAGGCATGG - Intronic
1111940677 13:94603310-94603332 TGTGGGATGTATAGAAGACGTGG + Intronic
1113337753 13:109393288-109393310 AGAGGGTGGTGTGGAAGACAGGG - Intergenic
1113501372 13:110777468-110777490 TGAGGCAGGTCCAGAGGACATGG - Intergenic
1113831457 13:113298539-113298561 TGAGGGATTTAAAGAAGTCAAGG - Intronic
1114084347 14:19228677-19228699 TTAGGGAGGGAAAGAAGTCATGG + Intergenic
1114354595 14:21893390-21893412 TGTGGGAGGTATAGAAAATCTGG - Intergenic
1114660117 14:24338586-24338608 AGTGGGAGGTAGGGAAGACAAGG + Intronic
1114830913 14:26140404-26140426 GGAAGCAGGTAGAGAAGACATGG + Intergenic
1115249783 14:31333080-31333102 TGAGGAAGCTACAGAAGAAAAGG + Intronic
1115506911 14:34101667-34101689 GGAGGGATGAATGGAAGACATGG - Intronic
1116249097 14:42457957-42457979 TGATGGAGGAAGAGAAGACTAGG + Intergenic
1118252576 14:64176584-64176606 TGACGGTGGAAAAGAAGACAAGG + Intronic
1119054684 14:71407443-71407465 GGAGGGAGGGAGAGAAGAAAGGG - Intronic
1119723966 14:76910703-76910725 TGAGAGAGGTATTGAGCACATGG + Intergenic
1120125216 14:80734107-80734129 TGAGGGAGATGTTGAAGTCAGGG - Intronic
1120389839 14:83891990-83892012 TGTTGAAGGTATTGAAGACATGG + Intergenic
1120481237 14:85052599-85052621 TGGGGTAGGTATGGAAGACATGG + Intergenic
1120687038 14:87549398-87549420 GGTGGGAGCTATAGAAGATATGG - Intergenic
1121006067 14:90491440-90491462 AGAGGGATGTAGAGAAGACAGGG + Intergenic
1121630569 14:95418901-95418923 AGAGGGAGGAAAAGAAGAGAGGG - Intronic
1121877809 14:97469915-97469937 TGAGGCAGCTATGGAAGGCAGGG + Intergenic
1122711500 14:103661815-103661837 TGAGGGAGGTCTAGGAGAGCAGG - Intronic
1122758838 14:104005120-104005142 TGAGGGAGGGAGAGAAGAGAAGG - Intronic
1124611441 15:31212217-31212239 GGAGGGAGGGAGGGAAGACAGGG + Intergenic
1124791718 15:32733289-32733311 TGAGGGTGGGAGAGAAGAAAAGG + Exonic
1124868669 15:33519114-33519136 GGAGGGAGGTCTAGAATGCATGG + Intronic
1126105958 15:45147392-45147414 AGAGGGAGGGAGAGGAGACAAGG - Intronic
1126283655 15:46986606-46986628 TGACAGAGGAAAAGAAGACAAGG + Intergenic
1126317884 15:47390190-47390212 TGAGGGATGTGTAGCAGACATGG - Intronic
1127284969 15:57524466-57524488 TGAGGGGGCCATAGAAGAAAGGG + Intronic
1128192451 15:65715709-65715731 TGTGGGAGGTATAGATGACATGG - Intronic
1128192683 15:65718509-65718531 TGTGGGAGGTATAGATGACATGG - Intronic
1128245622 15:66130765-66130787 TGAGTGAAGTATCGGAGACAAGG - Intronic
1128419942 15:67482285-67482307 TGAGAGAGAAACAGAAGACAGGG - Intronic
1129696973 15:77746345-77746367 TGAGGGAGGAATGGAATTCATGG - Intronic
1130896058 15:88171353-88171375 TGAGGCTGCCATAGAAGACATGG + Intronic
1131341201 15:91602717-91602739 TGAGGGAGGGAGAGAGGACCAGG + Intergenic
1131545689 15:93313792-93313814 AGAGAGAGGGATAGAAGAAAGGG - Intergenic
1131557352 15:93411477-93411499 TGAGAGAGGTGTGGAAGGCAAGG - Intergenic
1132500520 16:282824-282846 TGAGGGAGGTAGGGGAGACACGG - Exonic
1132518125 16:375357-375379 TGAGCGAAGTATTGAAGCCAAGG + Exonic
1133643739 16:7743437-7743459 TAAGGGAGGGATAGGACACAGGG - Intergenic
1134462237 16:14439402-14439424 GGAGGGAAGGAAAGAAGACAGGG + Intronic
1134802555 16:17098986-17099008 TTAGGGAGGTATAGAGGAACTGG + Intergenic
1137529187 16:49266274-49266296 TCAGGGAGGGACAGCAGACAAGG + Intergenic
1137552238 16:49445554-49445576 TGAATGAGGCATAGAACACAGGG + Intergenic
1137826724 16:51503917-51503939 TGAGGGAAGTGTAGGAAACAAGG + Intergenic
1137857202 16:51806814-51806836 TGAGGGAGAGAAAGAAGAGAGGG + Intergenic
1138096121 16:54213398-54213420 TGAGGGTGGCATGCAAGACAAGG + Intergenic
1138264667 16:55651925-55651947 TGAGGGAGGGAAAGAAGCAAAGG + Intergenic
1139556930 16:67718480-67718502 TGAGGGAGGAAGAGTGGACAGGG - Intronic
1140350703 16:74259615-74259637 TTATGGAGCTATAGAAGACCTGG - Intergenic
1140398740 16:74652252-74652274 TGAAGCAGGTATAGCAGATAAGG + Intronic
1143946207 17:10594814-10594836 TGTGGAAGGTCTAGAAGACCAGG - Intergenic
1145827968 17:27891540-27891562 TGAGGCAGGTGAAGAAGTCAAGG - Intronic
1146437917 17:32868537-32868559 TGAGGGAGGAAGAAATGACAAGG + Intronic
1147311274 17:39597318-39597340 TTAGGGAGGTGGAGAAGACCGGG + Intergenic
1148577906 17:48724392-48724414 CGAGGAAGATAAAGAAGACATGG + Exonic
1148673639 17:49432078-49432100 TGATGGAGGTAAAGAAGGAAGGG + Intronic
1148833060 17:50448612-50448634 TCACAGAGGTAAAGAAGACAAGG + Intronic
1149573942 17:57697958-57697980 TGAGGGAGGGAGTGAAGGCATGG - Intergenic
1155355093 18:24944194-24944216 TGAGGGAGGTGGAGAGGCCAGGG + Intergenic
1155596726 18:27496501-27496523 TCAGGGAGTAATAGAAGGCAAGG + Intergenic
1156616961 18:38798671-38798693 TGAGGTAAGTAAAGAAGAAAAGG + Intergenic
1157458008 18:47854999-47855021 TGTGGGAGGTAAAGAGGACTAGG - Intronic
1157598844 18:48880407-48880429 AGAGGGAGCTACAGAAGGCATGG + Intergenic
1158041520 18:53100530-53100552 GGAGGGAGGGAAAGAAGAAAGGG + Intronic
1162171185 19:8790262-8790284 GGAGGGAGGGAAAGAAGAAAGGG + Intergenic
1164459075 19:28432448-28432470 AGAGGGAGGTATTGAGGATACGG + Intergenic
1164538395 19:29103944-29103966 GGAGGGAGGTAGAGAAATCAGGG + Intergenic
1164784830 19:30921829-30921851 TTTGTGAGGCATAGAAGACATGG - Intergenic
1164934301 19:32199198-32199220 AGAGGCAGGAATAGATGACATGG + Intergenic
1165101305 19:33440209-33440231 TGAGTGAGGTGGGGAAGACAGGG - Intronic
1166853717 19:45772082-45772104 TGAGGGAGGTAGGGAAGGGAGGG - Intronic
1168539288 19:57197076-57197098 TGACGGAGGAAGAGAAGACTAGG - Intronic
925772702 2:7298690-7298712 TGACAGAGGAAGAGAAGACAAGG - Intergenic
925861015 2:8174912-8174934 CAAGGGAGGAATAGAAGTCAAGG - Intergenic
926287935 2:11505458-11505480 TCAGGGAAGTATAGAAGAGCTGG - Intergenic
926534409 2:14092817-14092839 GAAGGGAGGAATAGAAGAGAGGG + Intergenic
927858459 2:26542401-26542423 AGAGGGAGATATATCAGACATGG + Intronic
928429865 2:31208385-31208407 TGAGGGAGGTTCTGAAGCCAAGG - Intronic
928753706 2:34499232-34499254 TGAGGTAGATAAAGAAGAAAAGG + Intergenic
928989208 2:37213891-37213913 TGAAGAAAGTATAGAAGACGTGG - Exonic
929495869 2:42442580-42442602 TGTCAGAGGTAGAGAAGACAGGG - Exonic
929672693 2:43890035-43890057 TGAGGGATGTAGAGAAGTGAGGG - Intronic
929833692 2:45374301-45374323 GGTGGGAGGAATAGAAGTCAGGG - Intergenic
930743566 2:54858396-54858418 TGAGGAAGGTATAAAGGTCAAGG + Intronic
932116067 2:69048950-69048972 TGAGGGACGTAAACGAGACATGG - Intronic
932701730 2:73996835-73996857 TGAGGGAGGGATCGAAAAGAAGG + Intronic
932775787 2:74527568-74527590 GGAGGGAGGGAAAGAAGACTGGG + Exonic
932870662 2:75394756-75394778 TGACAGAGGAATAGAAGACTGGG - Intergenic
933182898 2:79247125-79247147 TGTGGGAGGAATTGTAGACAAGG + Intronic
933306665 2:80609027-80609049 TGAGGGAGGAGAAGAAGCCAAGG - Intronic
933528021 2:83468521-83468543 GGAGGGAGGGATAGAGAACAAGG - Intergenic
935425059 2:102911000-102911022 TGACAGAGGAAAAGAAGACAAGG - Intergenic
936904459 2:117521118-117521140 AGAGGGAGGAAGAGAAGGCAGGG + Intergenic
939467296 2:142574759-142574781 TGAGGATTGTATTGAAGACATGG - Intergenic
939776884 2:146398923-146398945 TAAGGTAGGTCTTGAAGACAGGG + Intergenic
941521061 2:166543572-166543594 GGAGGGAAGGAAAGAAGACAAGG + Intergenic
941563182 2:167075260-167075282 AGAGGGAGGTGAAGAAGAAAGGG + Intronic
943113847 2:183641995-183642017 GGAGGTAGGTAAAGAAGATAGGG - Intergenic
943384023 2:187180766-187180788 TGACAGAGGTAGAGAAGACTAGG - Intergenic
945801632 2:214439244-214439266 TGAATGATATATAGAAGACATGG + Intronic
946027431 2:216680200-216680222 AGAGGGAGGCAATGAAGACAGGG - Intronic
946274291 2:218618974-218618996 TGAGGGAGGAATGGATGCCAAGG + Intronic
947463555 2:230323061-230323083 TGGGGGAGGTCCAGAAGGCAGGG + Intergenic
948004911 2:234600160-234600182 TGAGGGAGGCACAGAGGACATGG - Intergenic
1169042425 20:2507545-2507567 TGAGGAAGGTGTAGAACTCATGG - Intronic
1172034792 20:32003121-32003143 TTAGGGAGGAAGAGACGACAGGG - Exonic
1172876294 20:38166318-38166340 TGAGGGAGGGAGGGAAGAGAAGG - Intronic
1173268222 20:41506463-41506485 TGAAGGAGGTAAAGGAGAGAGGG - Intronic
1173546985 20:43905168-43905190 TGAGGGAAGGAAGGAAGACAAGG + Intergenic
1173920651 20:46742435-46742457 GGAGGGAGGAAGAGAGGACAAGG - Intergenic
1175253845 20:57626479-57626501 TGAGTGCGGGACAGAAGACAGGG + Intergenic
1175501538 20:59454441-59454463 TGAGGGATGGAAAGTAGACAAGG - Intergenic
1175684331 20:61016435-61016457 TGAGTCAGTTATAGAAGAGACGG - Intergenic
1175947618 20:62566057-62566079 TGATGGACGGATAGAAGACCAGG + Intronic
1177509068 21:22060001-22060023 TCTGGGAAGTATAGAAGATAGGG + Intergenic
1178184978 21:30208771-30208793 TGGGGGAGATATACAATACATGG + Intergenic
1178379147 21:32093603-32093625 AGAGGGAGGGAAAGAAGAAAGGG - Intergenic
1179987653 21:44930460-44930482 TGAGGCAGGGGCAGAAGACAGGG + Intronic
1180261247 21:46670602-46670624 GGAGGCAGGGATAGAAGTCATGG + Intergenic
1180293625 22:10864525-10864547 TTAGGGAGGGAAAGAAGTCATGG - Intergenic
1180496430 22:15893940-15893962 TTAGGGAGGGAAAGAAGTCATGG - Intergenic
1180591101 22:16938040-16938062 TGAGGGAGGAAGAGAAGACTAGG - Intergenic
1180722143 22:17917473-17917495 TGAGGATGATAGAGAAGACATGG - Intronic
1181324244 22:22032585-22032607 TCAGGGAGGGATCGAAGTCATGG + Intergenic
1182032037 22:27167019-27167041 TGCGGGAGGTAAAGGACACAAGG - Intergenic
1182557537 22:31137316-31137338 TGAGGGTGGGAGAGAAGACAAGG + Intronic
1182636848 22:31734773-31734795 TGTGAGAGGTATAGAAAACCAGG - Intronic
1183013815 22:34969676-34969698 TGAGGGAGGTGGGGAAGAAAAGG + Intergenic
1183554088 22:38511606-38511628 TGAGCGAGAGAGAGAAGACAGGG + Intergenic
1183603900 22:38857601-38857623 GGAGGGAGGGATAGGAGACAAGG - Intergenic
1184813329 22:46852217-46852239 TGAGGGAAATACAGAAGAAAGGG + Intronic
1184831169 22:46989102-46989124 TGAGGAAGTTACAGAAGAAAGGG - Intronic
949791641 3:7799035-7799057 TGAGGGAGTTTTAGAAGAGGGGG + Intergenic
950009347 3:9711831-9711853 AGAGGGAGATTTAAAAGACAAGG - Intronic
950210061 3:11116646-11116668 AGAGAGAGGGACAGAAGACAGGG - Intergenic
950627603 3:14259544-14259566 TGAGGGAGGCTGAGCAGACACGG - Intergenic
950671213 3:14526703-14526725 TTAGAGAGATAAAGAAGACATGG - Intronic
951148311 3:19256131-19256153 TGAGTAAGATATAGAAGCCAGGG - Intronic
951335266 3:21413499-21413521 GGAGGGAGGTACAGTTGACATGG - Intergenic
951392086 3:22118435-22118457 TGAGGGAGGGAGTGAAAACATGG + Intronic
952220689 3:31321214-31321236 GGAGGCAGGTAGAGAAGACTGGG + Intergenic
952818114 3:37463075-37463097 TGAGGGAGGGAAAGGAGACCAGG + Intronic
953485345 3:43289286-43289308 TCAGGGAGGGTGAGAAGACAAGG + Intronic
954172491 3:48816078-48816100 GGAGAGAGGTATAGGAGGCAAGG - Intronic
955219234 3:57010131-57010153 GGAAGAGGGTATAGAAGACAAGG - Intronic
955968013 3:64408932-64408954 TGAGGTATATATAGAAGTCATGG + Intronic
956190185 3:66600700-66600722 GGAGGGAACTATACAAGACAGGG - Intergenic
957213040 3:77285512-77285534 TCAAGGTGGTATAGGAGACAAGG - Intronic
958777752 3:98506109-98506131 TTATGGAGGTATAGAAAAAATGG + Intronic
959176366 3:102916911-102916933 GGAGGGAGGAAGAGAAGACAGGG - Intergenic
959426400 3:106194342-106194364 TGTGGGAAGTAGAGAAGAAATGG + Intergenic
960058703 3:113296710-113296732 TGTGGGAGGTAAGGAAGAGAAGG - Exonic
960081047 3:113540688-113540710 GGAAGGGGGTACAGAAGACAAGG - Intronic
960089790 3:113627696-113627718 TGTTGGAGGTTCAGAAGACAGGG - Exonic
960138403 3:114128760-114128782 TGAAGGTGGTATAGATCACAGGG + Exonic
961851265 3:129821691-129821713 TGAGGGTGGGATGGAAAACAGGG - Intronic
961970207 3:130955702-130955724 TGAGGGAGGATTAAAAGACCTGG + Intronic
962555308 3:136544342-136544364 GGAGGGATGTATAGAAGGCTTGG - Intronic
964865082 3:161248765-161248787 TTAAGCAAGTATAGAAGACAGGG - Intronic
965212117 3:165804551-165804573 GGAGGGAGGTAGAGAGGACTTGG + Intronic
965333789 3:167410197-167410219 GGAGGTAGGGATGGAAGACAAGG - Intergenic
965578817 3:170245588-170245610 TGAGGGAGAGGAAGAAGACAGGG - Intronic
966659364 3:182397241-182397263 TGAGGGAGGTGTTGGAGAGAGGG - Intergenic
967292677 3:187936416-187936438 TGAGGCAGGTATAGAAGTCAGGG - Intergenic
967443464 3:189536824-189536846 TGAGGGAGGGATCGGAGCCAGGG - Intergenic
968424212 4:510836-510858 TGGGGGAGGGAGAGAAGACTGGG - Intronic
969316573 4:6385020-6385042 GGAGGGAGGAAGAGAAGACGAGG + Intronic
970484266 4:16508395-16508417 TGGGGGAGGGATAAAAGACAGGG - Intronic
970816186 4:20158905-20158927 TGCTGGATGTATAGAAGGCATGG - Intergenic
971546070 4:27889249-27889271 GAAGGGAGGAATAGAAGAGAAGG - Intergenic
972107340 4:35506003-35506025 TGATGGAGAGCTAGAAGACAGGG + Intergenic
973036763 4:45416732-45416754 TGAGAGAGGAAGAGAAGACTTGG + Intergenic
973609631 4:52623152-52623174 TAAGGGAGATAGAGCAGACAGGG + Intronic
973692738 4:53455055-53455077 TGAGGGAGCTGCAGAAGAAATGG - Intronic
975596708 4:76053760-76053782 TGACAGAGGTACAGAGGACATGG - Intronic
975982567 4:80176954-80176976 TGACAGAGGAAGAGAAGACAAGG - Intergenic
976890923 4:90046689-90046711 TGAGTGAGGCAGAGAAGAAAGGG + Intergenic
978963086 4:114708083-114708105 TGAGTGGGTTAAAGAAGACAAGG + Intergenic
979564031 4:122134200-122134222 TCAGGCAGGAATAGCAGACAAGG - Intergenic
980416816 4:132499565-132499587 TGATGGAGGTAGAAAAGAGAGGG - Intergenic
980519934 4:133918357-133918379 TCATGGAGGTAGAGAAGAGATGG - Intergenic
981845957 4:149169458-149169480 TGTGAGAGGAGTAGAAGACAGGG + Intergenic
983839705 4:172441839-172441861 TGAGGGAGCTAGGGAAGACGTGG + Intronic
983864604 4:172749806-172749828 TGTGAGAATTATAGAAGACATGG - Intronic
984443029 4:179797332-179797354 TGAGGGAGGGAGGGAAGGCAAGG + Intergenic
985061166 4:186080951-186080973 AGAGAGAAGTATAGAAGAAAGGG + Intronic
987466223 5:18275251-18275273 TGATGGAGGAAGAGAAGACTGGG - Intergenic
987741601 5:21915922-21915944 AGAGGGAGGGGTAGAAAACAAGG + Intronic
987815557 5:22896806-22896828 AGGGGGAGGTGGAGAAGACATGG + Intergenic
988539549 5:32096671-32096693 GGAGGGAGATGTAGAAAACATGG + Intronic
988631978 5:32941314-32941336 TGAGCAAGGAATAGAAGAAAAGG + Intergenic
988665811 5:33326255-33326277 TGAGGGAGGGAAACAAAACAGGG - Intergenic
991734703 5:69621088-69621110 TAAGGGAGGAATAGAAAACTGGG - Intergenic
991780275 5:70125633-70125655 TAAGGGAGGAATAGAAAACTGGG + Intergenic
991811137 5:70476229-70476251 TAAGGGAGGAATAGAAAACTGGG - Intergenic
991859562 5:71001047-71001069 TAAGGGAGGAATAGAAAACTGGG + Intronic
991872722 5:71125944-71125966 TAAGGGAGGAATAGAAAACTGGG + Intergenic
992097820 5:73379508-73379530 TGAGGGTGGTAGAGAATTCAGGG + Intergenic
992449158 5:76860036-76860058 TGAATGAGGTATATCAGACAGGG + Intronic
992760368 5:79945848-79945870 TTAGTGAGGTATAGCAGGCATGG + Intergenic
992884813 5:81148001-81148023 TGAGGAAGGTAAGGAAGGCAAGG - Intronic
994744397 5:103660973-103660995 TGAGGGGGGCATAGAAGGTATGG + Intergenic
995376763 5:111482581-111482603 TGAGGGAGTATGAGAAGACAGGG - Intronic
995811600 5:116113593-116113615 TGAAGGAGATATAAAATACATGG - Intronic
996794743 5:127332972-127332994 TGAAGGAGGCAGAGAAGACGAGG + Intronic
996825609 5:127678166-127678188 TGACGGAGGAAGAGAAGACTAGG + Intergenic
998064923 5:139150397-139150419 TGAGTAGGGGATAGAAGACAGGG - Intronic
998440903 5:142161460-142161482 AGAGGGCGGCAAAGAAGACATGG - Intergenic
999016577 5:148112759-148112781 TGGTGGAGGTATAGAAGTAATGG + Intronic
999699794 5:154217965-154217987 TGGGGTAGGGATAGAAGAAAGGG + Intronic
999751663 5:154632206-154632228 GGAGGGAGGGAGAGAAGAGAGGG - Intergenic
999859183 5:155627131-155627153 GGAGGGAGTAATGGAAGACAGGG + Intergenic
1000862462 5:166472944-166472966 TCAGGGAGGTATGGAAGAGCTGG + Intergenic
1001127420 5:169032472-169032494 TGAGTAAGGCTTAGAAGACATGG - Intronic
1001221244 5:169902791-169902813 TGAGGGAGACATAAAAGAAAGGG + Intronic
1001234222 5:170015820-170015842 GGAGGGAGGGAAAGAAGAAAAGG - Intronic
1001234229 5:170015845-170015867 GGAGGGAGGGAAAGAAGAAAAGG - Intronic
1001451542 5:171828880-171828902 AGAGGAAGTTTTAGAAGACATGG + Intergenic
1002557295 5:180052731-180052753 GGAGGGAGGAAGAGAATACAAGG + Intronic
1003629903 6:7777422-7777444 TGAGGGAGCTTTAGAATACTTGG - Intronic
1004671886 6:17804922-17804944 TGAGGTAGATAAGGAAGACAAGG - Intronic
1004693857 6:18015793-18015815 TAAGGCAGGTCTGGAAGACAGGG + Intergenic
1004824250 6:19402908-19402930 TGATGGAGGAAGAGAAGACTAGG - Intergenic
1006270928 6:32967188-32967210 TGAGAGTGGTATAGAAGTCAAGG + Intronic
1006864992 6:37202153-37202175 TGAGGAGGGTATGGAAGACAAGG - Intergenic
1007160043 6:39783331-39783353 TCAAGGAGGAATAGGAGACATGG - Intergenic
1007263833 6:40582667-40582689 TGAGGGTTGTATAGAAGGTATGG - Intronic
1008662757 6:53685358-53685380 TGAGGCAGGCATGGAAGAAAAGG - Intergenic
1009513390 6:64581869-64581891 TCAGAGTGGTAGAGAAGACAGGG + Intronic
1009896690 6:69760432-69760454 TAAGGGAGAAATAGAAGAAATGG + Intronic
1009924089 6:70098825-70098847 TGAAGGAGGGAAACAAGACAAGG + Intronic
1010746438 6:79567531-79567553 TTAGAGAGGTGTAGAAGAAACGG + Intergenic
1011454872 6:87537625-87537647 TAAGGAAGGTAAGGAAGACATGG + Intronic
1012091943 6:94909346-94909368 TGAAGGAGGGAAAGAAGAGAGGG - Intergenic
1014197868 6:118579738-118579760 TTAGGCAGATAGAGAAGACAAGG + Intronic
1014377686 6:120696417-120696439 GGAGGGAGGGAAAGAAGAAAGGG + Intergenic
1014537720 6:122635216-122635238 TGAGGAAGGTAAGGAAGGCATGG + Intronic
1015317049 6:131828632-131828654 TGAGTGTGGTATTGAAAACACGG + Intronic
1016491815 6:144613209-144613231 TGAGGGAGGGAGAGAAGGAAGGG + Intronic
1017227761 6:152040764-152040786 TGACAGAGGAAGAGAAGACAAGG - Intronic
1018301606 6:162408968-162408990 AGAGGCAGGGATGGAAGACAAGG - Intronic
1018484555 6:164227839-164227861 TGAGGGAGATGGAGGAGACATGG + Intergenic
1021626961 7:22603064-22603086 TGAGAGAGGAAGAGAAGAGAGGG - Intronic
1025945976 7:66104854-66104876 TGAGGAAGCTGTAGAAGAAAAGG - Intronic
1026098946 7:67368932-67368954 TGAGGGAGGAAGAGAAGAACAGG - Intergenic
1026278920 7:68904482-68904504 AGAGGGAGGAAGAGAAGAAATGG + Intergenic
1026434822 7:70386769-70386791 AGAGAGAGGCAGAGAAGACAAGG - Intronic
1027862896 7:83607701-83607723 TGAGTAAGGTTTAGAAGAGAAGG + Intronic
1030855817 7:114555934-114555956 TGAGGGAGGTATAGAAGACAAGG - Intronic
1031801734 7:126255242-126255264 TGAAGAAGGTATACAAGAAATGG + Intergenic
1031976726 7:128098607-128098629 TGAGGAAGGTTTTGAGGACAGGG + Intergenic
1032375573 7:131413155-131413177 TGAGGGAAGGAAAGAAGAAAAGG + Intronic
1032436515 7:131905352-131905374 TTTGGGAGGTATTGAAGAGAAGG + Intergenic
1033050413 7:137999272-137999294 TGAGGGGGATAGAGAATACAAGG - Intronic
1033141799 7:138833896-138833918 TGAGGGAGTTTCAGAAGAGAAGG - Intronic
1033223548 7:139544128-139544150 TGAGGGAGGGATAGGTCACAGGG + Intronic
1034012935 7:147549802-147549824 TGGGGGAAGAAAAGAAGACATGG - Intronic
1034184640 7:149165480-149165502 GGAGGCAGGTAGAGAAGAAATGG + Intronic
1038560053 8:28567604-28567626 TGGGGGGGCTATAGAAAACAAGG + Exonic
1039311938 8:36326048-36326070 TGAAGAAGGCATGGAAGACAAGG + Intergenic
1040777842 8:51068779-51068801 TGAGTGTAGTATAGAAGAGAAGG + Intergenic
1041597526 8:59673522-59673544 TGAGGCAGAGAAAGAAGACAGGG - Intergenic
1042127963 8:65558058-65558080 TGAGCGAGGGATAGAAGGGAAGG - Intergenic
1046086236 8:109439114-109439136 TGATGGAGTTGTAGAACACATGG + Intronic
1046211551 8:111082617-111082639 TGTGGAAGGTAAAGAAGAGAGGG - Intergenic
1046897942 8:119493482-119493504 TGAGGGGTGTATAGAAGATTTGG - Intergenic
1047223269 8:122936221-122936243 GCAGGGAGGTGTTGAAGACAGGG + Intronic
1047370706 8:124253531-124253553 GGAGGGAGCTAGAGAAGAAAAGG - Intergenic
1047537865 8:125735639-125735661 TGAAGGAGGTAAAGATGACAGGG + Intergenic
1047785101 8:128146513-128146535 TGGGGCAGATAGAGAAGACAGGG - Intergenic
1051876374 9:21798251-21798273 TGAGGGAGGTATAGGGTTCAGGG + Intergenic
1051937270 9:22458303-22458325 TGTGGCAGGAATAGAAGCCATGG + Intergenic
1052180014 9:25514311-25514333 TGATGGTAGTATAGATGACAAGG + Intergenic
1052356385 9:27509303-27509325 AGAGGGAGGGAGAGAAGAGAAGG + Intronic
1053004998 9:34598661-34598683 TGAGGGACTTCCAGAAGACAGGG + Intergenic
1053039696 9:34859356-34859378 TGAGGGGGGAATTGAAAACAGGG + Intergenic
1053472256 9:38355213-38355235 GGAGGGAGGAAGAGAAGGCAAGG + Intergenic
1055176535 9:73324562-73324584 TAAGGATGGTATAGAAGAAAAGG - Intergenic
1056311188 9:85342438-85342460 TGAGGGAACTATAGAACAAAAGG + Intergenic
1056904812 9:90636333-90636355 TGAGGTAGGGATGGAAGCCAAGG + Intronic
1057869562 9:98708150-98708172 TGGGGGTGGGATAGAAGACTGGG - Intronic
1057953301 9:99386937-99386959 TGAGTGAGACCTAGAAGACAGGG + Intergenic
1058900548 9:109438762-109438784 TCAGGGAGGTGTGGAAGAAAGGG + Intronic
1059483232 9:114608410-114608432 CCAGGGAGGCACAGAAGACAGGG - Intergenic
1061264708 9:129498170-129498192 TGTGGGAGGTACAGGGGACAGGG + Intergenic
1061743952 9:132726268-132726290 GGAGGGAGGGAGAGAAGAGAGGG - Intronic
1186513499 X:10148922-10148944 TGTGGAAGGTATGGAAGGCAAGG + Intergenic
1187604913 X:20872188-20872210 TGACAGAGGAAGAGAAGACAAGG + Intergenic
1187965230 X:24605261-24605283 TGAGGCAAGCAGAGAAGACATGG - Intronic
1188463220 X:30451612-30451634 GGAGGGAGGTATTGAGGATAGGG + Intergenic
1189020171 X:37327831-37327853 AGAGGGGGGAAAAGAAGACAAGG + Intergenic
1191721464 X:64231965-64231987 TGAGTGAGGTAGACAAGACTGGG - Intergenic
1191841226 X:65514753-65514775 TGTGGGAGGGAGAGAAGACAAGG - Intronic
1192156963 X:68753851-68753873 TGAGGGAAAAATAGAAGTCAAGG - Intergenic
1194343358 X:92731408-92731430 TGACAGAGGAAGAGAAGACAAGG + Intergenic
1195392845 X:104381116-104381138 TGAGGCAGGTACAGAAGTCAAGG - Intergenic
1195934389 X:110111144-110111166 TGTGGGAGATGTAGAAGGCAGGG - Intronic
1196178580 X:112666452-112666474 ACAGGGAGGGATAGAAGAAAAGG + Intronic
1199081664 X:143583749-143583771 AGAAGGAGGTATAGAAGATGAGG + Intergenic
1200651713 Y:5848073-5848095 TGACAGAGGAAGAGAAGACAAGG + Intergenic