ID: 1030855819

View in Genome Browser
Species Human (GRCh38)
Location 7:114555949-114555971
Sequence CTCCCTCATCTCTACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030855816_1030855819 -7 Left 1030855816 7:114555933-114555955 CCCTTGTCTTCTATACCTCCCTC 0: 1
1: 0
2: 2
3: 57
4: 409
Right 1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG No data
1030855817_1030855819 -8 Left 1030855817 7:114555934-114555956 CCTTGTCTTCTATACCTCCCTCA 0: 1
1: 0
2: 3
3: 29
4: 369
Right 1030855819 7:114555949-114555971 CTCCCTCATCTCTACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030855819 Original CRISPR CTCCCTCATCTCTACCTGTC AGG Intronic
No off target data available for this crispr