ID: 1030856845

View in Genome Browser
Species Human (GRCh38)
Location 7:114568833-114568855
Sequence TCCTGTTTATGTACTCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030856844_1030856845 30 Left 1030856844 7:114568780-114568802 CCATAGTATTTTTATTTATTTTT 0: 2
1: 5
2: 72
3: 1293
4: 10457
Right 1030856845 7:114568833-114568855 TCCTGTTTATGTACTCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030856845 Original CRISPR TCCTGTTTATGTACTCCTCC AGG Intronic