ID: 1030856845 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:114568833-114568855 |
Sequence | TCCTGTTTATGTACTCCTCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1030856844_1030856845 | 30 | Left | 1030856844 | 7:114568780-114568802 | CCATAGTATTTTTATTTATTTTT | 0: 2 1: 5 2: 72 3: 1293 4: 10457 |
||
Right | 1030856845 | 7:114568833-114568855 | TCCTGTTTATGTACTCCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1030856845 | Original CRISPR | TCCTGTTTATGTACTCCTCC AGG | Intronic | ||