ID: 1030858146

View in Genome Browser
Species Human (GRCh38)
Location 7:114587806-114587828
Sequence TTGCAGAACTAGTGTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030858146_1030858148 11 Left 1030858146 7:114587806-114587828 CCATTCTCACACTAGTTCTGCAA 0: 1
1: 0
2: 1
3: 9
4: 223
Right 1030858148 7:114587840-114587862 AGTTCAAACAACTGCTAATTGGG 0: 1
1: 0
2: 0
3: 9
4: 209
1030858146_1030858147 10 Left 1030858146 7:114587806-114587828 CCATTCTCACACTAGTTCTGCAA 0: 1
1: 0
2: 1
3: 9
4: 223
Right 1030858147 7:114587839-114587861 AAGTTCAAACAACTGCTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030858146 Original CRISPR TTGCAGAACTAGTGTGAGAA TGG (reversed) Intronic
900873654 1:5325414-5325436 TTCCAGGACTTGTGTCAGAAAGG - Intergenic
902616633 1:17627224-17627246 TTGCAGACCCAGTGTGTGTAGGG + Intronic
903039950 1:20522015-20522037 TTGCAGAAATGAAGTGAGAATGG - Intergenic
903210812 1:21817170-21817192 TGGCAGAGCAGGTGTGAGAAGGG - Intronic
904555410 1:31359649-31359671 TTTCAGAACTATAGTGAAAATGG + Intronic
906190501 1:43896116-43896138 TTCCAGAAGTTGAGTGAGAATGG - Intronic
908106986 1:60855226-60855248 ATGAAGAACAAGTGGGAGAAAGG + Intergenic
914393697 1:147244145-147244167 TTTAAGAACTTGTGTGAGAGAGG + Intronic
915567640 1:156724893-156724915 TTCCAAAACTAGTGTGAATAAGG - Intronic
915919601 1:159964504-159964526 ATGCAGAACTTGTTTGAAAATGG + Intergenic
916622111 1:166510580-166510602 TTGAAGAAAGAGTGAGAGAAAGG + Intergenic
918071461 1:181136116-181136138 TTGCAGAATTACTGTGGGAATGG + Intergenic
919226810 1:194714821-194714843 AGGCAGAACTATTGTGACAACGG - Intergenic
919325136 1:196098033-196098055 GTGCAGAACTGCTGTAAGAAAGG - Intergenic
919501292 1:198341142-198341164 TTACAGAAGTAGTCTGGGAATGG - Intergenic
919610331 1:199738114-199738136 TTGCTGAACTGGTATGAGTATGG - Intergenic
919952386 1:202377290-202377312 TTGGAGTAGTAATGTGAGAAGGG + Intronic
922349081 1:224721218-224721240 TTGCTGAATGAGTGTGAAAATGG + Intronic
923965988 1:239139873-239139895 TTGGAGAGCTGGTGTGGGAATGG - Intergenic
924881439 1:248165460-248165482 GTGCAGTGCTGGTGTGAGAATGG - Intergenic
1063173135 10:3527769-3527791 TTGCAAAAATGGTGGGAGAAAGG - Intergenic
1064925582 10:20565380-20565402 TTCCAAATCTAGTGAGAGAATGG + Intergenic
1066811959 10:39351008-39351030 TTTGAGACCTAGGGTGAGAAAGG - Intergenic
1068829191 10:61473420-61473442 TGGCAGAACTGGAGTGAGACAGG - Intergenic
1069780966 10:70955065-70955087 GTCCAGAGCTAGTGGGAGAAAGG + Intergenic
1072065475 10:91865970-91865992 TTACAGGACTAGAGTGACAAAGG + Intergenic
1072954463 10:99876512-99876534 TTGCATAACTAATCTGGGAATGG + Exonic
1073810011 10:107142431-107142453 CTCAAGTACTAGTGTGAGAAAGG + Intronic
1074654143 10:115562848-115562870 GTTCATAACCAGTGTGAGAATGG + Intronic
1074937975 10:118204976-118204998 GGGCAGAACCACTGTGAGAAAGG - Intergenic
1076750872 10:132542272-132542294 TTGCAGAACGGCTGTGAGAGTGG + Intronic
1076886545 10:133265414-133265436 TTGCAGAAATAGTCCTAGAAGGG - Intronic
1079349813 11:19682967-19682989 TTGCAGAACTAGGATGAGGGAGG + Intronic
1080236941 11:30081020-30081042 TTACAGAACTATTGTGAGCCAGG + Intergenic
1080735436 11:35009387-35009409 TTCCTGAACTAGTGTTTGAATGG + Intronic
1080997734 11:37624578-37624600 CTGCAGAACGGGTGAGAGAAAGG - Intergenic
1085249187 11:75130945-75130967 GTGGAGAACAGGTGTGAGAATGG + Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1086099707 11:83086250-83086272 CATCAGAACTAGTGTGTGAAAGG + Intergenic
1088081798 11:105925954-105925976 GTGCAGAGCAAATGTGAGAAGGG - Intronic
1092025304 12:5234674-5234696 TTTCAGAACCAGTGTGGGATGGG + Intergenic
1094438655 12:30450628-30450650 TTGCAGAAAGAGTGAGAAAACGG - Intergenic
1095076587 12:37935908-37935930 TTTCAGAACTATGGTGAAAAGGG - Intergenic
1096649697 12:53055977-53055999 TTGCAGTACTAGTGATAAAAGGG - Intronic
1098175417 12:67785286-67785308 TTACAGAAGTAGGATGAGAATGG + Intergenic
1098842907 12:75498082-75498104 CTGCAGAACTGGTGTGGAAAAGG + Exonic
1101065101 12:101012801-101012823 TTGCAGTAGGAGGGTGAGAAAGG + Intronic
1101756981 12:107628859-107628881 TTACAGAGCTAGTGAGTGAAGGG + Intronic
1102941948 12:116950737-116950759 CTGCAGAACTAGTTTTAGAAAGG + Intronic
1105096753 13:16383628-16383650 TTTCAGGTCTAGGGTGAGAAAGG + Intergenic
1105100530 13:16445032-16445054 TTTCAGGTCTAGGGTGAGAAAGG + Intergenic
1105102338 13:16474684-16474706 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1105114834 13:16679004-16679026 TTTCAGGTCTATTGTGAGAAAGG + Intergenic
1105116851 13:16711747-16711769 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1105118769 13:16742952-16742974 TTTCAGGTCTATTGTGAGAAAGG + Intergenic
1105122856 13:16809839-16809861 TTTCAGGTCTAGGGTGAGAAAGG + Intergenic
1105123017 13:16812567-16812589 TTGCAGGTCTATGGTGAGAAGGG + Intergenic
1105127537 13:16886062-16886084 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1105127790 13:16890154-16890176 TTTCAGATCTATGGTGAGAAAGG + Intergenic
1105137098 13:17042618-17042640 TTTCAGGTCTAGGGTGAGAAAGG + Intergenic
1105141076 13:17107933-17107955 TTTCAGATCTATGGTGAGAAAGG + Intergenic
1105143622 13:17148859-17148881 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1105148294 13:17225095-17225117 TTGCAGGTCTATGGTGAGAAGGG + Intergenic
1105153300 13:17307016-17307038 TTGCAGGTCTATGGTGAGAAGGG + Intergenic
1105154361 13:17324735-17324757 TTTCAGCACTACGGTGAGAAAGG + Intergenic
1105154881 13:17332922-17332944 TTTCAGGTCTAGGGTGAGAAAGG + Intergenic
1105833979 13:24192635-24192657 GTGCAGACCTAGTGAGAGGAAGG - Intronic
1107395889 13:40017029-40017051 TTGCAGAATTATTTTTAGAAGGG - Intergenic
1108398310 13:50012010-50012032 TTGCAGAAGTTGTGGGAGCAAGG - Exonic
1110497674 13:76188639-76188661 CTGCATAACTTCTGTGAGAATGG + Intergenic
1111137148 13:84062789-84062811 TTTTAATACTAGTGTGAGAATGG - Intergenic
1111145425 13:84172238-84172260 TTGCAGAAGTTATGTGACAAAGG + Intergenic
1111882362 13:93973394-93973416 TTGCAGACCAAATGTGATAATGG - Intronic
1113017917 13:105849227-105849249 TCGAAGAATTAGTGTGAAAAAGG + Intergenic
1120678056 14:87445335-87445357 TTGCAGAAATAGAGTTAGCAGGG - Intergenic
1121701102 14:95954835-95954857 TTGCAGAACTAGGGAGGGGAGGG - Intergenic
1123302914 15:18372277-18372299 TTTCAGGCCTAATGTGAGAAAGG + Intergenic
1123312422 15:18531153-18531175 TTTCAGGACTAAGGTGAGAAAGG + Intergenic
1125023204 15:35005289-35005311 TTGGAGAACTTGTGTGAGAATGG - Intergenic
1125286945 15:38103488-38103510 TTGCAAAACTTTTGAGAGAAGGG + Intergenic
1128543833 15:68554497-68554519 TTGCAGAACTAGTCAGAAGATGG + Intergenic
1129550732 15:76445987-76446009 TTGTAGAAATAGTGGTAGAAGGG + Intronic
1130512090 15:84598379-84598401 TGGGAGAATTTGTGTGAGAAAGG + Intergenic
1130533223 15:84763760-84763782 ATGCAGGATTAGAGTGAGAATGG + Intronic
1131559414 15:93426512-93426534 TTCCAGAACAAGTTTTAGAAGGG - Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1131695588 15:94874519-94874541 TGGCAGAACTAGAGCGAAAAAGG - Intergenic
1133399753 16:5476865-5476887 TGGGAGAACTAGATTGAGAAAGG - Intergenic
1135045580 16:19152485-19152507 TTGCAGAGTTGGTGTGAGAATGG + Intronic
1135604367 16:23810448-23810470 TTGCAGAACTGCTAGGAGAAAGG + Intergenic
1138135558 16:54518277-54518299 TTGAAGAAATAGTGTCTGAAAGG + Intergenic
1138661041 16:58516990-58517012 TTGTAGCACTAGTAAGAGAATGG - Intronic
1139031015 16:62880627-62880649 TTGCAGAAAAATTGTGAGAGTGG + Intergenic
1143492490 17:7292509-7292531 GGGCAGAACAAGTTTGAGAAGGG + Intronic
1146455101 17:33003774-33003796 TTGCAGAATCAGTGAGTGAATGG + Intergenic
1157188021 18:45557275-45557297 TTGCAGAAACAGTTAGAGAATGG - Intronic
1157221597 18:45832097-45832119 GTGCAGGACTAGTGAGGGAAGGG + Intronic
1158511264 18:58092605-58092627 TTGCAGAGCCAGTATGTGAATGG - Intronic
1159483103 18:69016405-69016427 CTACAGAACTAGTGTCAGGAAGG + Intronic
1159551163 18:69896923-69896945 TTCCAGAAATGGTGTGAGGAAGG - Intronic
1159900954 18:74045121-74045143 TTGCAGAGCTAATGGGAGGAAGG - Intergenic
1164795603 19:31025054-31025076 TTATAGAACTAGTGTGATATTGG + Intergenic
1167611959 19:50512053-50512075 CTGCAGAACTAGTGAGAGCCCGG + Intronic
925476179 2:4218233-4218255 TTGCAGAACTAGTAAGGAAAGGG + Intergenic
926534545 2:14094308-14094330 ATGCACAAATAGTGTGAGATAGG - Intergenic
926645086 2:15282241-15282263 TTGAAGAGTTAGTGTGAGAGTGG - Intronic
929048078 2:37810207-37810229 TAGCAGAACTCATGTGAGTAGGG + Intergenic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
931581566 2:63781052-63781074 TTACAGAATTGGTTTGAGAAAGG + Intronic
934349096 2:92394257-92394279 TTTCAGGACTATGGTGAGAAAGG + Intergenic
934392541 2:93089310-93089332 TTTCAGGACTATGGTGAGAAAGG + Intergenic
934406794 2:93320084-93320106 TTTCAGGACTATGGTGAGAAAGG + Intergenic
935525958 2:104167554-104167576 TTGCAGAATTAATTTGTGAATGG + Intergenic
935639938 2:105280960-105280982 ATACAGAACTGGTGTGAGAGTGG + Intronic
936786593 2:116100523-116100545 CTGCAGAACTACTGTGATATTGG + Intergenic
937535970 2:122887384-122887406 TTGGAAAACAAGGGTGAGAAAGG + Intergenic
938028580 2:127972188-127972210 GTGCAGAAATAGGGTGAGCAGGG - Intronic
939685373 2:145192221-145192243 ATTCAGAACTAGTGTAACAAGGG - Intergenic
940291582 2:152082631-152082653 TTGCAAAACGGGGGTGAGAATGG - Intronic
942954559 2:181759119-181759141 TTGCAGAAGGTGAGTGAGAATGG + Intergenic
945049415 2:205808976-205808998 TTGCAGATCTAGTGTCATACGGG - Intergenic
948285579 2:236782142-236782164 CTGCAGAAGGTGTGTGAGAATGG + Intergenic
948322257 2:237080124-237080146 TTACTGAACTAGGGAGAGAAGGG - Intergenic
1170134492 20:13057983-13058005 TTGCAGAACTTGTTTGATATTGG - Intronic
1170207550 20:13814869-13814891 TTGCAGAAGCAGTGTGAGGGTGG - Intronic
1173106656 20:40143507-40143529 TCCCAGAACTACTGTGAAAAGGG + Intergenic
1179456149 21:41501688-41501710 TTGCAGATCTAATGTCAGAGCGG - Intronic
1184073365 22:42160842-42160864 TTTCTGAACTGGTGTGAGACAGG + Exonic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
952592449 3:34973515-34973537 TTGCAGAACAATTGGGAGAATGG + Intergenic
953127043 3:40101196-40101218 TTGCAGATATACTGGGAGAATGG - Intronic
953190977 3:40687948-40687970 CAGTAGAACTAGTGTGGGAATGG + Intergenic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
960909174 3:122631470-122631492 TAGCAGGACTAGTGTGAATACGG - Intronic
962484757 3:135831517-135831539 TTGGGGAACTAGTGTAAAAATGG - Intergenic
965164434 3:165177648-165177670 TTGCAGAAGTACTGTGTTAAAGG - Intergenic
965706515 3:171513456-171513478 GTGAAAAACTAGTGGGAGAAAGG - Intergenic
967408802 3:189146882-189146904 TTGCAGAAGTACTGTGGAAAAGG - Intronic
973422301 4:50005991-50006013 TTTCAGACCTATGGTGAGAAAGG + Intergenic
973497843 4:51253905-51253927 TTTCAGACCTATGGTGAGAAAGG + Intergenic
973958081 4:56083013-56083035 GTGCAGAATTAGAGAGAGAAGGG + Intergenic
974241330 4:59252207-59252229 TTACAGACCCAGTGGGAGAATGG - Intergenic
977352197 4:95902767-95902789 GGGCAGAACTAGTCTGAGAGTGG + Intergenic
977415547 4:96728389-96728411 TTCCAGTTCTAGAGTGAGAAAGG - Intergenic
979198541 4:117949290-117949312 TTGCAGAATTAGTCTGCTAAAGG - Intergenic
980501860 4:133666257-133666279 TTGGAGAACAATTGTGTGAAAGG - Intergenic
980835389 4:138185726-138185748 TTAAAGGACTAGTGTTAGAAAGG - Intronic
982120583 4:152139197-152139219 TTGCAGAGCTAGTGGGGAAATGG + Intergenic
984623389 4:181978290-181978312 TGGCAGAACCAGGATGAGAAGGG + Intergenic
986642834 5:9889060-9889082 TTTAAGAAATAGTCTGAGAATGG - Intergenic
987078360 5:14404360-14404382 TTTCAGAAATAGTAAGAGAAAGG - Intronic
987172274 5:15271121-15271143 CTGCAGAGCTAGAGTGAGAAAGG - Intergenic
988702468 5:33689033-33689055 TTGCAGAAGTGGTGACAGAAAGG - Intronic
996295960 5:121916784-121916806 TTGCAGGACTGGTGTGAGTGGGG - Intergenic
998192164 5:140035263-140035285 TTGGAGAAGTAGTTTGAGAAGGG - Intronic
998656739 5:144189594-144189616 TTGCAGACCTAGGTTAAGAATGG + Intronic
999291245 5:150427846-150427868 CTGCTGAACAAGTGAGAGAAGGG - Intergenic
999824925 5:155264846-155264868 TAGCAGAGCTAGTGTTGGAATGG + Intergenic
1001795211 5:174496420-174496442 TTTCAAAACTTCTGTGAGAATGG - Intergenic
1003173243 6:3736510-3736532 TTGCAGCACTATTTTGACAAAGG - Intronic
1004047007 6:12035882-12035904 TTTCAGAACTAGTATGAAAAAGG + Intronic
1005902934 6:30234723-30234745 TTTCTGAACTATTTTGAGAATGG + Intergenic
1008287078 6:49666890-49666912 TTGCAAAAATAGTGACAGAAGGG + Intergenic
1009835877 6:69001237-69001259 GTACAGAAATAGTGTAAGAATGG + Intronic
1012316701 6:97790223-97790245 TTGGAGAAATAGTTGGAGAAAGG - Intergenic
1012343609 6:98158269-98158291 TGGCAGAACTAAAGGGAGAAAGG + Intergenic
1013062941 6:106654828-106654850 TTGAATAACTGGTGTGAGGAAGG - Exonic
1013300314 6:108799038-108799060 TTGGAAAAGTAGTGTGAGCAGGG - Intergenic
1022384313 7:29887565-29887587 CTGGAGAACCAGTGTGAGCAGGG + Intronic
1022792977 7:33707114-33707136 TTGCTGACCCAGTGTGAGATGGG - Intergenic
1024301611 7:47891279-47891301 TTGCAGAAAGACTGTGAGACTGG - Intronic
1024439591 7:49401149-49401171 TTAGAGAGCTAGTATGAGAATGG + Intergenic
1028720918 7:94030341-94030363 AAGCAGAAATAGTGTGGGAATGG + Intergenic
1030662051 7:112230277-112230299 TGGCCGTACTAATGTGAGAATGG + Intronic
1030858146 7:114587806-114587828 TTGCAGAACTAGTGTGAGAATGG - Intronic
1037569440 8:20146252-20146274 TGGAAGAACTAGTGGGAGGACGG - Intronic
1038712798 8:29963540-29963562 TTCCAGAACAAGATTGAGAATGG - Intergenic
1039119103 8:34125988-34126010 TGGCTGAAATATTGTGAGAATGG - Intergenic
1040146119 8:44046798-44046820 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040149080 8:44090639-44090661 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040156868 8:44205998-44206020 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040163510 8:44304334-44304356 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040210591 8:45001706-45001728 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040231081 8:45304075-45304097 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040233461 8:45339267-45339289 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040244898 8:45507696-45507718 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040246253 8:45527751-45527773 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040246740 8:45534711-45534733 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040252168 8:45615055-45615077 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040253486 8:45634405-45634427 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040257259 8:45689951-45689973 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040257509 8:45693687-45693709 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040262934 8:45773836-45773858 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1040269216 8:45866679-45866701 TTTCAGAACTATGGTGAAAAAGG + Intergenic
1041348124 8:56922540-56922562 TTGCAAACCTAGTGTTAGAAAGG + Intergenic
1046079845 8:109358466-109358488 TTGCAGAACTAGAGGGAATAAGG - Intergenic
1046788487 8:118293927-118293949 TTAGAGATCCAGTGTGAGAATGG - Intronic
1048814659 8:138321167-138321189 TTGCAGAATTATTGTGAGGCAGG + Intronic
1052235422 9:26207872-26207894 TTGAAGAACTAGGGTGGGAGTGG + Intergenic
1053107810 9:35427350-35427372 CCTCAGAACTAGTGAGAGAATGG + Intergenic
1053578524 9:39378396-39378418 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1053843048 9:42206475-42206497 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1053950834 9:43377322-43377344 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1053965002 9:43628006-43628028 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1053975905 9:43816387-43816409 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1053995883 9:44162182-44162204 TTTCAGACCTATGGTGAGAAAGG + Intergenic
1054004082 9:44306355-44306377 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1054010435 9:44416946-44416968 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1054010554 9:44418986-44419008 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1054021692 9:44610703-44610725 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1054024796 9:44664285-44664307 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1054029373 9:44742366-44742388 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1054030758 9:44766522-44766544 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1054034990 9:44838799-44838821 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1054072751 9:45483477-45483499 TTTCAGGACTATGGTGAGAAAGG + Intergenic
1054100108 9:60937201-60937223 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054121505 9:61212828-61212850 TTGTAGAAAAAGTGAGAGAAAGG - Intergenic
1054586237 9:66969684-66969706 TTGTAGAAAAAGTGAGAGAAAGG + Intergenic
1059372267 9:113851633-113851655 TTGAAGAACTAATGTTAGAGGGG - Intergenic
1059727533 9:117024083-117024105 TTGAAGAACTCGTTTGAGGATGG - Intronic
1062307825 9:135919675-135919697 TTGCAGAACCTGGGGGAGAAGGG - Intergenic
1203419837 Un_KI270382v1:365-387 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1203594171 Un_KI270747v1:107204-107226 TTTCAGGCCTATTGTGAGAAAGG + Intergenic
1187790452 X:22944614-22944636 TTCTAGAACTAGTGTTTGAAAGG + Intergenic
1191110715 X:56801480-56801502 TTGCAGAACAAAAGTGAGAAAGG + Intergenic
1193919797 X:87410923-87410945 TTATAGTAGTAGTGTGAGAATGG - Intergenic
1194160383 X:90442268-90442290 TTGCAGAGCTAGTGTGCCACAGG + Intergenic
1194702691 X:97133701-97133723 TTGAAGACCAAGAGTGAGAATGG - Intronic
1195263895 X:103161248-103161270 TTGCACAAATATGGTGAGAAGGG + Intergenic
1196821001 X:119700651-119700673 TTGGAGAACTACTGCGTGAATGG + Intergenic
1200506675 Y:4019216-4019238 TTGCAGAGCTAGTGTGCCACAGG + Intergenic
1200925701 Y:8652658-8652680 TTTCAGACCTTGTATGAGAAAGG + Intergenic
1201080073 Y:10234573-10234595 TTTGAGGACTAGTGTGGGAAAGG - Intergenic
1201479076 Y:14418056-14418078 TTGGAGAACAAATATGAGAAGGG + Intergenic