ID: 1030861089

View in Genome Browser
Species Human (GRCh38)
Location 7:114630433-114630455
Sequence CAGTAGCAGTTCATTAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030861089_1030861092 -9 Left 1030861089 7:114630433-114630455 CCCTGATTAATGAACTGCTACTG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1030861092 7:114630447-114630469 CTGCTACTGTAGGTTGAGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030861089 Original CRISPR CAGTAGCAGTTCATTAATCA GGG (reversed) Intronic
901760970 1:11471322-11471344 CAGTAGCACTTCATCACACATGG - Intergenic
906466087 1:46080811-46080833 CAGGAGCAGCTCACTAACCAAGG + Intronic
907849053 1:58236307-58236329 CAGTAACAGCTCATTTAGCAGGG + Intronic
907897911 1:58710062-58710084 CAGTAGGAGCTCATTAATGCTGG - Intergenic
908631497 1:66114248-66114270 CAGTAGAAATTCATTTCTCAGGG - Intronic
909143283 1:71894326-71894348 CTGTAGTAGTTCAAGAATCAGGG + Intronic
911447083 1:98010168-98010190 CAGTAGCATGTCAATAATAATGG - Intergenic
912822678 1:112880310-112880332 TATTAGCAATTCATGAATCAGGG + Intergenic
920090684 1:203450813-203450835 CTGAAGTAGTTTATTAATCAGGG + Intergenic
920923408 1:210318359-210318381 GAATAGCACTTCATTAAACATGG + Intergenic
923481733 1:234391550-234391572 CAGCAGCAGTTCACTAAGGAAGG + Exonic
923934643 1:238747261-238747283 CAGTAGGAGGTAATGAATCATGG + Intergenic
1071791567 10:88959653-88959675 AAATATCAGTTCATTAATTATGG - Intronic
1071903187 10:90142593-90142615 CAACATCAGTTCATTCATCATGG - Intergenic
1073150083 10:101305524-101305546 CAGTAGCTATTCAGGAATCAGGG + Intergenic
1081129694 11:39363808-39363830 CTGTGGAATTTCATTAATCAGGG - Intergenic
1086333224 11:85774817-85774839 CATTAGTACTTCATTAATTAGGG + Intronic
1089141201 11:116285928-116285950 AAGGAGCAGTTTATTAATCAAGG + Intergenic
1094365870 12:29680588-29680610 TAGTTGCAGTTTATCAATCAGGG - Intronic
1097091922 12:56512741-56512763 CTGTCACAGTTCATTAATAAAGG - Intergenic
1097379355 12:58876615-58876637 CAGCAGCATTTTATTAACCAAGG + Intronic
1099150218 12:79102118-79102140 CAGGAGGAGTTCAATAAGCAGGG - Intronic
1105575312 13:21645615-21645637 CAGTAGAAGTTCTTAAATCATGG + Intergenic
1107296033 13:38908821-38908843 CAGAAGCAGTTCATCTATCCAGG + Intergenic
1107351607 13:39520465-39520487 TAGTAGCAATTCATCAAGCAAGG + Intronic
1109852755 13:68088737-68088759 CAGGAGGAGGTAATTAATCATGG - Intergenic
1110158326 13:72344868-72344890 AGGTTGCAGTTCATTAATAAAGG + Intergenic
1113713601 13:112488281-112488303 CAGTCGCTGATCACTAATCATGG - Intronic
1115197080 14:30812812-30812834 CAGGACCAGTTCCTCAATCACGG - Intergenic
1116389048 14:44369905-44369927 CAGTTGAAGATTATTAATCATGG - Intergenic
1117208832 14:53474105-53474127 CAGCAGCACTTCTTCAATCATGG - Intergenic
1118080244 14:62350223-62350245 CAATATTAGTTTATTAATCATGG + Intergenic
1121662886 14:95649079-95649101 CAGCAGCAGTTTATTGATCCTGG - Intergenic
1122387043 14:101356146-101356168 TGGTAGCAGTCCATTAAGCATGG - Intergenic
1124836095 15:33197388-33197410 CAGTAACTGTTTATTAAGCAAGG - Intergenic
1129014887 15:72458029-72458051 CAGTAGCATTTTTTTAAACAGGG + Intergenic
1129931690 15:79416491-79416513 CAGAACCACTTCATTAATAATGG + Intronic
1134608457 16:15589462-15589484 CAGTAGAAGGTCATTCATTATGG - Intronic
1135919964 16:26641116-26641138 CAGTAGCAGTGAATAAATAAGGG - Intergenic
1137701068 16:50498199-50498221 CAGTGGCATGTCATGAATCAAGG - Intergenic
1138814907 16:60192677-60192699 CAGTAGTAGTGAAATAATCATGG - Intergenic
1149098608 17:52875365-52875387 CAGCTGCAGTTCATTTATCTGGG - Intronic
1150577563 17:66443653-66443675 CAGTAGCAAGTCATTTACCAAGG - Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154254672 18:12772094-12772116 CAGAAGGAGTTCAGTAATGAAGG - Intergenic
1156051774 18:32944757-32944779 CAGTGGGAGATAATTAATCATGG + Intronic
1156730368 18:40186991-40187013 CTGTCTCAGTTCATCAATCAGGG + Intergenic
1158390555 18:57041385-57041407 CAGTAGCAGTGAAGGAATCAAGG - Intergenic
1166691723 19:44825669-44825691 CAGAAGCAGTTTATTACTTATGG + Intergenic
927527360 2:23757736-23757758 CAGCAGCAGTTCCTTAAACCCGG - Exonic
929577478 2:43061126-43061148 CAATAGCAGTTTATTAATTGTGG - Intergenic
929912526 2:46102482-46102504 CAGTATTAGTTCATTAATAGGGG - Intronic
930939632 2:56998267-56998289 CAGAGGGAGGTCATTAATCAAGG - Intergenic
933033819 2:77366945-77366967 CAGAAGGAGTTCATTAATGAAGG - Intronic
933723999 2:85416067-85416089 AAGTAGGAGTTTATTAATAATGG - Intronic
939009595 2:136830220-136830242 CAGTAGCAGATCCGTAATCAAGG + Intronic
939801693 2:146719396-146719418 CAATAGCAGTTATTTAATGAAGG - Intergenic
944241208 2:197487004-197487026 CTGTCACAGTTCATTAATAAAGG + Exonic
944609029 2:201381163-201381185 CGGTAGCAGTTCATCCAACACGG - Exonic
946529092 2:220552282-220552304 CAGTAGGAATTAATTTATCAAGG + Intergenic
948250358 2:236523266-236523288 CAGTACCACTTAATTCATCAGGG + Intergenic
1169688086 20:8299608-8299630 CAGTTGCAGTTGAGAAATCAGGG - Intronic
1170105409 20:12750149-12750171 CAGTAGCAATTTATTGAACAGGG - Intergenic
1172392996 20:34578946-34578968 AAGTTCCAGTTCATCAATCATGG - Intronic
1178533852 21:33396667-33396689 TAGGAGCAGTTTATTAACCAAGG - Intergenic
1182523952 22:30903881-30903903 CAGTACAATTTCATTTATCAAGG - Intronic
1182916759 22:34040469-34040491 CAGTGGGAGATAATTAATCATGG - Intergenic
951695137 3:25438488-25438510 GAGTAGCATTTCATTAAACATGG - Intronic
954971451 3:54654785-54654807 CAGTAGCAGTAAATTAACCTAGG - Intronic
956613292 3:71145934-71145956 CAGTAGCTTGTCTTTAATCAGGG + Intronic
963882925 3:150548152-150548174 CAGAAGCAGTTCAGTATTGATGG - Intronic
966028369 3:175314140-175314162 CAGTAACATTTTATTATTCAAGG - Intronic
967807118 3:193725293-193725315 CAGTTTCAGTTCATTATACATGG - Intergenic
970778034 4:19701083-19701105 CAGTACATCTTCATTAATCATGG - Intergenic
972819337 4:42681741-42681763 AAGCAGCAGTTCAGGAATCAAGG - Intergenic
978593061 4:110347085-110347107 CAGTAACAGTTTATTCATTATGG + Intergenic
980429646 4:132676864-132676886 CAGTAGCAGTTAATATATTAAGG - Intergenic
981446678 4:144847367-144847389 CTGTCACAGTTCATTAATAAAGG - Intergenic
987739260 5:21884332-21884354 CTGTCACAGTTCATTAATAAAGG - Intronic
988585683 5:32505596-32505618 GAGTAGCACTTCATTAAAAAAGG - Intergenic
989334920 5:40304797-40304819 CAGTAGCAGTTAACTAGGCAAGG - Intergenic
989636102 5:43535847-43535869 CAATAGCAGAACTTTAATCATGG + Intronic
991313976 5:65278728-65278750 CATTAGCAGTTAATTTAGCAAGG + Intronic
991384731 5:66073333-66073355 CAGAACCAGTTAATTACTCATGG + Intronic
993680199 5:90868351-90868373 CAGCAGCCTTTCATTAATGAGGG - Intronic
999248667 5:150168489-150168511 CATTAGCTGTTATTTAATCAAGG - Intronic
1001754827 5:174160087-174160109 CTGGAGCAGGTCACTAATCAAGG - Intronic
1004580621 6:16947619-16947641 CAGTCGCTCTTCATTAATAATGG - Intergenic
1008835711 6:55825427-55825449 CACTATCAGTCCATTAATCATGG - Intronic
1011230969 6:85161696-85161718 CAGGAGCAGTTAAGTACTCAGGG + Intergenic
1015064414 6:129006622-129006644 CAGAGGCAGTTCAGAAATCAAGG - Intronic
1015217763 6:130769643-130769665 CAGTAGCACCTCCTTATTCATGG - Intergenic
1017288464 6:152706148-152706170 CTGTCACAGTTCATTAATAAAGG - Intronic
1018309307 6:162491880-162491902 CAGCAGCAGTTTATTTCTCAGGG - Intronic
1030861089 7:114630433-114630455 CAGTAGCAGTTCATTAATCAGGG - Intronic
1035981783 8:4380643-4380665 CAATATCAGTTCATTAATTGTGG + Intronic
1035992900 8:4511694-4511716 CAGCAGCAGTTCATCAGTTACGG - Intronic
1037864390 8:22431544-22431566 GAGGAGCTGGTCATTAATCAAGG + Intronic
1038478587 8:27886164-27886186 CAGTGTCGGTTCATTAAGCATGG + Intronic
1039731258 8:40281021-40281043 CTCTAGCAGTTCATCAATTACGG + Intergenic
1041216932 8:55610062-55610084 CAGTAGCAGTTCAGAAGCCAAGG + Intergenic
1046516523 8:115269238-115269260 CAATACTAGTTCATTAAACAAGG + Intergenic
1046605471 8:116366703-116366725 AAGTAGCAGTTCATGATTTAAGG + Intergenic
1047094076 8:121605382-121605404 AAGCAGGAGTTCAGTAATCATGG - Intergenic
1048761524 8:137800918-137800940 CACTTGCAGTCCATTAATAAGGG + Intergenic
1056174494 9:84020790-84020812 TAGTAGTAGTTCATTCATGAAGG + Intergenic
1058830163 9:108809174-108809196 CAGCTCCTGTTCATTAATCAAGG - Intergenic
1060822187 9:126667851-126667873 CAGTAGCTGCTCAGTAAGCAAGG + Intronic
1186294979 X:8139368-8139390 CATTAGCCGTTAATTAAACAGGG + Intergenic
1186690313 X:11968468-11968490 CAGTAGCAGTTCACGAGTCCAGG - Intergenic
1187992560 X:24890921-24890943 CAGCATCAGTTCATGAAGCAAGG - Intronic
1190938045 X:55014163-55014185 AAGTAGCAGTTCATTTTTAAAGG + Intronic
1196394692 X:115246733-115246755 CAGTACCAGTTCGTTACCCAGGG + Intergenic
1200861088 Y:7993641-7993663 CTGTAGCACTTCATTAATTAAGG + Intergenic