ID: 1030865055

View in Genome Browser
Species Human (GRCh38)
Location 7:114691659-114691681
Sequence TTATGAGGTCCCTTGGTTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 91}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030865055_1030865063 19 Left 1030865055 7:114691659-114691681 CCCCCAACCAAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1030865063 7:114691701-114691723 TTACAAACAGTTTTGACAGAAGG 0: 1
1: 0
2: 3
3: 12
4: 247
1030865055_1030865064 22 Left 1030865055 7:114691659-114691681 CCCCCAACCAAGGGACCTCATAA 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1030865064 7:114691704-114691726 CAAACAGTTTTGACAGAAGGTGG 0: 1
1: 0
2: 2
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030865055 Original CRISPR TTATGAGGTCCCTTGGTTGG GGG (reversed) Exonic
900352207 1:2240479-2240501 TGAGGAGGTCCCGTGGGTGGTGG + Intronic
905476036 1:38228931-38228953 TCAAGAGGCCCCTTGGATGGAGG + Intergenic
907564018 1:55417759-55417781 TGAGGAGACCCCTTGGTTGGAGG + Intergenic
910860615 1:91739625-91739647 CTGTGAGGTCCCTTGGTAGTTGG - Intronic
920550700 1:206858481-206858503 CTATGAGGTCCCATGGAGGGGGG + Intergenic
1065480231 10:26185737-26185759 ATACTAGTTCCCTTGGTTGGGGG - Intronic
1066352448 10:34648932-34648954 TGATGGTGTCCCTTGTTTGGAGG - Intronic
1067341893 10:45412392-45412414 TCATGGGGTCCTTGGGTTGGGGG + Intronic
1077697908 11:4411889-4411911 TTAAGATGTCCCATGGCTGGAGG - Intergenic
1080047797 11:27827272-27827294 CTCTGAAGCCCCTTGGTTGGAGG + Intergenic
1084054384 11:66622760-66622782 AAATGAGGACCCTTGTTTGGAGG + Intronic
1090800199 11:130166081-130166103 TGATGAGGTTCCTTAGCTGGTGG + Intronic
1095493073 12:42756595-42756617 TGGTTAGGTCCCTTGGTTTGTGG - Intergenic
1098183254 12:67870109-67870131 TCATGGCGTCCCTTGGCTGGGGG + Intergenic
1103559044 12:121782685-121782707 TTTGGAGGTCCCTGGGTTGAGGG - Intronic
1110152885 13:72276226-72276248 TTGTGAGGACCCCTGCTTGGGGG - Intergenic
1111260079 13:85725791-85725813 TTATTAGGTCATTTGGTTAGAGG - Intergenic
1112288179 13:98122582-98122604 TTGGGAGCTCCCATGGTTGGAGG - Intergenic
1116002110 14:39254985-39255007 TTATGAGGTTTCTAGCTTGGGGG + Intronic
1116373567 14:44168296-44168318 TTATGAAGTCCCTAGCGTGGAGG - Intergenic
1116803458 14:49467304-49467326 TTGTGAGGTCCCATTGTAGGAGG - Intergenic
1116984751 14:51206597-51206619 TTTTGAGGTCTCCTGGATGGGGG - Intergenic
1117213263 14:53523699-53523721 TTATGAAGGCCCTTGGTCTGGGG + Intergenic
1125536326 15:40442433-40442455 TCATGATGTGCCTTGGCTGGTGG + Intronic
1126897464 15:53274605-53274627 ATATGAGGTACCATTGTTGGTGG - Intergenic
1127618800 15:60713277-60713299 TGAAGAGGTCACTTGGTTTGAGG + Intronic
1128507768 15:68288482-68288504 TTATCAGGTCTTTTGGTTAGTGG + Intronic
1135486324 16:22868735-22868757 TTCTGAGGTCCCTGAGCTGGGGG + Intronic
1136379215 16:29884283-29884305 TGATGAGGTTACTCGGTTGGTGG + Intronic
1137374325 16:47939851-47939873 TTATGAGCTCCTGTGTTTGGAGG + Intergenic
1137711477 16:50569847-50569869 TGATGGGGTTCCTTGGATGGAGG + Intronic
1138911078 16:61399541-61399563 TTATGACCTACCTTGGTAGGAGG - Intergenic
1139817877 16:69690756-69690778 TTATGAAGTGCATTGGCTGGGGG - Intronic
1148129605 17:45254961-45254983 TTATGAGGTCACTGAGGTGGAGG + Intronic
1149435988 17:56633927-56633949 ACATGAGGTGCCTGGGTTGGAGG - Intergenic
1150490307 17:65569647-65569669 TTCTGAGATCACTTGGTTGGTGG - Intronic
1165419341 19:35715373-35715395 GGCTGAGGCCCCTTGGTTGGTGG + Exonic
1166295095 19:41885052-41885074 TTAGAAGGTCCATGGGTTGGGGG - Intronic
1168663096 19:58182999-58183021 TTATGACGTCCCTTGGGAAGAGG - Intronic
930082121 2:47459469-47459491 TTAAGAAGTTCCTTTGTTGGAGG + Intronic
930723632 2:54661814-54661836 TTATGTGGTTCCTTTTTTGGAGG - Intronic
938310140 2:130284286-130284308 CTGAGAGGTCCCTTGGCTGGAGG + Intergenic
938444780 2:131368083-131368105 CTGAGAGGTCCCTTGGCTGGAGG - Intergenic
938948679 2:136237537-136237559 TTCTGTGGTCCCTGGGTAGGTGG - Intergenic
940191959 2:151050508-151050530 TTATTTGGTCCCTTGGTGGCAGG - Intergenic
946883994 2:224204954-224204976 TTATGGGGTCCTTGGATTGGTGG - Intergenic
947350894 2:229243707-229243729 TGATTAGTTCCCTTGGGTGGTGG - Intronic
948062476 2:235051967-235051989 GTTTGATGTCCCTTGGTTTGTGG - Intronic
1172865342 20:38092076-38092098 GTATGAGGTGACTTGGTGGGTGG + Exonic
1175888212 20:62303977-62303999 GTGTGAGGTGCCTGGGTTGGAGG + Intronic
1177843669 21:26263186-26263208 ATATGAGGCCACTTGGTGGGAGG - Intergenic
953157252 3:40386649-40386671 TTATGTGGTCCCCCGGTGGGTGG - Intergenic
956177456 3:66486404-66486426 TTATGAGGGGCCATGGTTGTGGG - Intronic
956386525 3:68725306-68725328 TTATGAGGTGCCATGGGTGGGGG + Intergenic
962343586 3:134604327-134604349 TTGTGAGTGCCCATGGTTGGAGG + Exonic
965047362 3:163597026-163597048 TTATATGGTCCCTTTGTGGGTGG - Intergenic
966959569 3:184921479-184921501 GTGTAAGGCCCCTTGGTTGGTGG + Intronic
969529409 4:7722415-7722437 TTATGGGGTCCCTAGGAAGGAGG - Intronic
970304654 4:14718852-14718874 TCATGACTTCCCTTGGTTAGGGG - Intergenic
974263064 4:59549733-59549755 TTTTGAGGTACGGTGGTTGGAGG - Intergenic
979089853 4:116468656-116468678 TGATGAGGTAGCTTGGTTAGAGG - Intergenic
979723420 4:123931244-123931266 TTCTGAGTTCACGTGGTTGGTGG + Intergenic
990313904 5:54566529-54566551 TCATGAGGTCTCTTTGTTAGGGG - Intergenic
993133082 5:83923746-83923768 TTCTGAGGTACCTTGGTTAAAGG + Intergenic
998772728 5:145564872-145564894 TTATGGCGTCCCTTGGCTAGAGG + Intronic
1002503652 5:179664210-179664232 TTATGTGTTGCCTTTGTTGGTGG + Intergenic
1004190267 6:13457456-13457478 TCAGGAGGACCCTGGGTTGGGGG - Intronic
1011630364 6:89317227-89317249 TTGTGAGATCCCTAGGTAGGGGG + Intergenic
1012984425 6:105859666-105859688 TTAAGAGAGCCCTTGGGTGGAGG - Intergenic
1014272442 6:119349455-119349477 TTATCAGGTCCCGTGGGTAGGGG + Intronic
1017520303 6:155195955-155195977 TTGTGAGGTCCATTTATTGGAGG + Intronic
1021397358 7:20166723-20166745 TTTTGAGTTCCCAGGGTTGGAGG - Intronic
1021576416 7:22109664-22109686 TTACGAGGGTGCTTGGTTGGGGG + Intergenic
1028292369 7:89081360-89081382 TTATGAGAGCACCTGGTTGGGGG - Intronic
1029696539 7:102217414-102217436 TGATGAGGCCCTGTGGTTGGCGG - Intronic
1029895828 7:103982735-103982757 TTTTCAGGTCACTTGGTTTGTGG + Intronic
1029978968 7:104860423-104860445 TTATGAGCTCCCTTTATTAGCGG - Intronic
1030865055 7:114691659-114691681 TTATGAGGTCCCTTGGTTGGGGG - Exonic
1034097609 7:148424605-148424627 TTATGGCTTCCCTTGGCTGGGGG - Intergenic
1044135913 8:88584998-88585020 TTATGGTCTCCCTTGGCTGGAGG + Intergenic
1044847659 8:96398008-96398030 TTGTGGGGGCCCTTTGTTGGGGG + Intergenic
1049030031 8:140028227-140028249 TTATGAAGTCTCTTGGATTGAGG - Intronic
1051763447 9:20495908-20495930 TTATGAGGACCCTTTGTTACAGG - Intronic
1054872378 9:70059836-70059858 TCATGAGCTCCCTTGACTGGAGG + Intronic
1056002105 9:82228168-82228190 TTATGAGGTGCCGTGGTAGTGGG + Intergenic
1060077972 9:120611625-120611647 TTTTTAGGTCCTTTTGTTGGGGG + Intronic
1060977106 9:127771249-127771271 TTAGGAGGTCCCCGGGTTGCCGG - Intronic
1062529565 9:136993956-136993978 TAAACAGCTCCCTTGGTTGGAGG + Exonic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1190336631 X:49266702-49266724 GGATGAGGTCCCCTGCTTGGAGG + Intergenic
1192822161 X:74656916-74656938 TCATCACCTCCCTTGGTTGGGGG + Intergenic
1196760935 X:119200317-119200339 TCATGAGATCCCTAGGGTGGAGG + Intergenic
1197904975 X:131415006-131415028 TTATGTCCTCCCCTGGTTGGGGG + Intergenic
1198251231 X:134880814-134880836 TTATGATGGCCCTTGGTTGTGGG - Intergenic
1201563743 Y:15345121-15345143 TCATGAGGGCCCTTGCTTTGTGG + Intergenic