ID: 1030865263

View in Genome Browser
Species Human (GRCh38)
Location 7:114694754-114694776
Sequence ATTTTGTGCTGTTGAATCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030865260_1030865263 7 Left 1030865260 7:114694724-114694746 CCTGTAGTTTAAAACACTTGTTA No data
Right 1030865263 7:114694754-114694776 ATTTTGTGCTGTTGAATCAATGG No data
1030865259_1030865263 29 Left 1030865259 7:114694702-114694724 CCTAAATTCAAACTCTTGTGATC No data
Right 1030865263 7:114694754-114694776 ATTTTGTGCTGTTGAATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030865263 Original CRISPR ATTTTGTGCTGTTGAATCAA TGG Intergenic
No off target data available for this crispr