ID: 1030868959

View in Genome Browser
Species Human (GRCh38)
Location 7:114732869-114732891
Sequence GCAACGGTGTTAGTAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030868950_1030868959 9 Left 1030868950 7:114732837-114732859 CCCATTCTTGGGCCCCAGGATGG No data
Right 1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG No data
1030868956_1030868959 -5 Left 1030868956 7:114732851-114732873 CCAGGATGGCATACATTGGCAAC No data
Right 1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG No data
1030868954_1030868959 -3 Left 1030868954 7:114732849-114732871 CCCCAGGATGGCATACATTGGCA No data
Right 1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG No data
1030868955_1030868959 -4 Left 1030868955 7:114732850-114732872 CCCAGGATGGCATACATTGGCAA No data
Right 1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG No data
1030868952_1030868959 8 Left 1030868952 7:114732838-114732860 CCATTCTTGGGCCCCAGGATGGC No data
Right 1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030868959 Original CRISPR GCAACGGTGTTAGTAGGACC AGG Intergenic
No off target data available for this crispr