ID: 1030883506

View in Genome Browser
Species Human (GRCh38)
Location 7:114911349-114911371
Sequence GGATAAAAAGAGATGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030883502_1030883506 29 Left 1030883502 7:114911297-114911319 CCCAGAAGAGATTTGTCTGCTCT No data
Right 1030883506 7:114911349-114911371 GGATAAAAAGAGATGGACCAAGG No data
1030883503_1030883506 28 Left 1030883503 7:114911298-114911320 CCAGAAGAGATTTGTCTGCTCTT No data
Right 1030883506 7:114911349-114911371 GGATAAAAAGAGATGGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030883506 Original CRISPR GGATAAAAAGAGATGGACCA AGG Intergenic
No off target data available for this crispr