ID: 1030884916

View in Genome Browser
Species Human (GRCh38)
Location 7:114924563-114924585
Sequence TTCAGGCCACTCTAGATTTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030884916_1030884921 25 Left 1030884916 7:114924563-114924585 CCGAAAATCTAGAGTGGCCTGAA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1030884921 7:114924611-114924633 TTATCAGTGTAGAAACTCTTGGG No data
1030884916_1030884920 24 Left 1030884916 7:114924563-114924585 CCGAAAATCTAGAGTGGCCTGAA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1030884920 7:114924610-114924632 GTTATCAGTGTAGAAACTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 140
1030884916_1030884917 -10 Left 1030884916 7:114924563-114924585 CCGAAAATCTAGAGTGGCCTGAA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1030884917 7:114924576-114924598 GTGGCCTGAAGTACATTTGTTGG 0: 1
1: 0
2: 1
3: 7
4: 125
1030884916_1030884918 -9 Left 1030884916 7:114924563-114924585 CCGAAAATCTAGAGTGGCCTGAA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1030884918 7:114924577-114924599 TGGCCTGAAGTACATTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030884916 Original CRISPR TTCAGGCCACTCTAGATTTT CGG (reversed) Intronic
901634798 1:10665499-10665521 TTCAGGCCACCCTTGCGTTTGGG + Exonic
905210457 1:36370376-36370398 TCCAGGCCACTCCAGGTTTGTGG + Intronic
907126379 1:52054776-52054798 TTGAGGCCTCTCTAAATTATTGG - Intronic
907701139 1:56789244-56789266 ATCAGGGCACTCTAGCTGTTGGG - Intronic
908524223 1:64972361-64972383 TTCAGGGCAGTGTAGATTTGTGG + Intergenic
909011818 1:70343532-70343554 TTAAGACCACTTTAGCTTTTAGG + Intronic
911566373 1:99467168-99467190 TTCAGGCATCTCTAGTTTTTAGG + Intergenic
918535930 1:185574387-185574409 TTCAGGGCCCACTACATTTTGGG + Intergenic
919328883 1:196143642-196143664 TTCAGGTCACTCAACATTTCAGG - Intergenic
921114752 1:212078824-212078846 TTCTGGCCTTTCTACATTTTAGG - Intronic
1068213526 10:53952794-53952816 CTCAGCCCACTCTGGACTTTGGG - Intronic
1069932524 10:71892268-71892290 GTCAAGGCACTCTAGATTTTCGG - Intergenic
1071133580 10:82426082-82426104 TCCAGCCCACTCTAGCCTTTCGG + Intronic
1071740997 10:88357975-88357997 TTCAGGCCATTAAAGTTTTTGGG + Intronic
1071801166 10:89062871-89062893 TTGAGGCCACACTGGGTTTTTGG - Intergenic
1075007739 10:118842655-118842677 TTCAGCCCCCTCTGGACTTTGGG + Intergenic
1079826532 11:25202074-25202096 TTCAGGCCAATTGAGATTATTGG + Intergenic
1081226057 11:40523921-40523943 TTCAGGTGACTCTAGATTTTGGG + Intronic
1081284067 11:41246243-41246265 ATCAGCCCACTCTGGACTTTGGG - Intronic
1083414873 11:62518938-62518960 TTCAGGTCACCCTCTATTTTTGG + Exonic
1084702758 11:70798301-70798323 TTCAGGACTTTCTAGATCTTTGG - Intronic
1084762392 11:71282419-71282441 TCCAGGCCACCCTCGAGTTTGGG + Intergenic
1085386718 11:76161895-76161917 TCCAGGCCACTCCAGATGGTAGG + Intergenic
1085424925 11:76395948-76395970 GTCTTGCCACTCTAGATGTTAGG + Intronic
1086484061 11:87278032-87278054 TTCAGGACAGTCTAAATTCTTGG + Intronic
1087208652 11:95423155-95423177 TTCAGGCCACTCAAGCTTATAGG - Intergenic
1087591239 11:100190753-100190775 TTGAGGTCACTCTTGGTTTTAGG + Intronic
1089075258 11:115733557-115733579 TGCAGGGCAGTCTGGATTTTTGG - Intergenic
1090587836 11:128233570-128233592 TTCAGGGCACTCTGGACCTTTGG + Intergenic
1092918570 12:13210070-13210092 ATTAGATCACTCTAGATTTTTGG + Intronic
1097686588 12:62696813-62696835 TTAAGGCCACTCCACCTTTTTGG - Intronic
1099713828 12:86264903-86264925 CTCAGCCCTCTCTGGATTTTGGG + Intronic
1107699883 13:43036774-43036796 TTCAGCCCCCTCTAGACTTTGGG - Intronic
1109837400 13:67877618-67877640 TTCAGCCCCCTCTGGATGTTAGG + Intergenic
1109988069 13:70016588-70016610 TTCAGCCCCCTCTGAATTTTGGG + Intronic
1112287761 13:98119125-98119147 TTCATTCCACTCCAGATTCTTGG + Intergenic
1113305098 13:109068962-109068984 TCCAGGCCACTCTACATTCAAGG + Intronic
1113916259 13:113875746-113875768 CTCTGGGCACTCTAGATTTCAGG - Intergenic
1114764838 14:25359166-25359188 TTCAGCTAACTCCAGATTTTAGG - Intergenic
1115148196 14:30251648-30251670 TTCAGGTGACTCTAGTTTCTGGG - Intergenic
1118001915 14:61530910-61530932 GTCAGGCCACACCAGAGTTTTGG + Intronic
1121757339 14:96414051-96414073 TGTAAGCCACTCTACATTTTGGG - Intronic
1124330561 15:28810627-28810649 TTCAGGCCACAGTAGATCATAGG - Intergenic
1125335460 15:38622218-38622240 TTCAGACCAATCTGGATTTTGGG + Intergenic
1125752312 15:42037039-42037061 TTCAGCCCCCTCCAGACTTTGGG + Intronic
1128954210 15:71922299-71922321 TTTAGGTCACTGTATATTTTTGG + Intronic
1130175460 15:81564619-81564641 GTCAGGAGACTCTACATTTTTGG - Intergenic
1133658010 16:7885594-7885616 TGCAGGCCACTGTAGGGTTTTGG + Intergenic
1133872298 16:9700833-9700855 TCCAGGCCACTCTAATTCTTGGG + Intergenic
1135336969 16:21609900-21609922 TTCAGGCCACTTTTAATTTCTGG + Intronic
1135484373 16:22851173-22851195 TTGAGGCCAGTCTAGATTCAAGG + Intronic
1135488554 16:22887168-22887190 TTCAGTCCACTGTAAATCTTTGG + Intronic
1138262670 16:55636475-55636497 GTCTGGCCACTCTTGAGTTTTGG - Intergenic
1138703273 16:58887569-58887591 GTCAGGACACTCTACATTGTGGG + Intergenic
1140357060 16:74315434-74315456 TTCATGCCACTCTACATTTGAGG - Intergenic
1140842378 16:78852023-78852045 TTCAAGTCACTCTTGATTGTGGG - Intronic
1143582341 17:7834562-7834584 TTCAGGCCCCTCTGGACATTTGG - Intergenic
1144088418 17:11831651-11831673 TTCAGGCAGCTCTAGGATTTGGG - Intronic
1145841343 17:27997655-27997677 TTCAGGCCTCTCTGGATTTGGGG + Intergenic
1152156435 17:78636749-78636771 TTGAGGCCACGCTTGATATTTGG - Intergenic
1156244482 18:35284492-35284514 TTCAGCCCCCTCCAGACTTTGGG - Intronic
1159753073 18:72327132-72327154 TTCATGCATCTCCAGATTTTGGG + Intergenic
926163638 2:10504924-10504946 TTCTGGCCAGTATAGGTTTTCGG + Intergenic
930393490 2:50790373-50790395 CTCAGGCATTTCTAGATTTTGGG + Intronic
930479235 2:51926187-51926209 TTGAGGCCACTTAAGATTTGAGG - Intergenic
935557633 2:104527820-104527842 TTCAGGACCATCTAGATTTGTGG + Intergenic
936058005 2:109275871-109275893 TTGAGTCCACTCTAGGTTTATGG + Intronic
936519297 2:113201723-113201745 ATGAGGCCACTCTGGATTCTGGG - Exonic
939279977 2:140050943-140050965 TTCAGACCACAGTTGATTTTAGG + Intergenic
939529996 2:143346945-143346967 TTCAGGGCAAACTAGATTCTGGG + Intronic
940011240 2:149057932-149057954 TCCAGGCCACTCTAGGGCTTAGG - Intronic
940259783 2:151767532-151767554 TTCAGGCAGCTCTAGTTGTTAGG - Intergenic
940398765 2:153222681-153222703 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
941130634 2:161645713-161645735 TTCAGCCAACACTAAATTTTTGG - Intronic
941799502 2:169642022-169642044 TTAAGAACACTCCAGATTTTGGG - Intergenic
943174686 2:184456244-184456266 TTCATGTCTCTCTAGATTTCTGG - Intergenic
945828385 2:214752238-214752260 TTGAGCCCACTCTGTATTTTAGG - Intronic
948575458 2:238946901-238946923 TTCAGCCCCCTCTGGACTTTGGG - Intergenic
1172052720 20:32131402-32131424 TACAGGTCAGTCTACATTTTTGG + Intronic
1175959961 20:62631026-62631048 CTCAGCCCCCTCCAGATTTTGGG - Intergenic
1176428774 21:6563872-6563894 TCCAGGCCAGTCTGGATCTTGGG - Intergenic
1176993175 21:15522418-15522440 TTCAGCCCCCTCTGGACTTTGGG - Intergenic
1177723801 21:24941847-24941869 TTCAGTGTACTCTAGATTGTAGG + Intergenic
1177875454 21:26626183-26626205 CTCAGCCCCCTCTAGACTTTGGG - Intergenic
1179607622 21:42527426-42527448 TCCAGGCCACTCAAGACTTAGGG + Intronic
1179704264 21:43172188-43172210 TCCAGGCCAGTCTGGATCTTGGG - Exonic
1182905374 22:33931337-33931359 TAAGGGACACTCTAGATTTTGGG - Intergenic
1184560950 22:45262695-45262717 CTCAGCCCTCTCCAGATTTTGGG - Intergenic
949130204 3:490739-490761 TTAAGGCCACTGTAGTTATTTGG + Intergenic
951035133 3:17924657-17924679 GTCTGGCAACTCTAGATTTAGGG + Intronic
951718523 3:25674083-25674105 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
951801162 3:26597364-26597386 CTCAAGCCACTCTAGTTTATAGG + Intergenic
953478210 3:43224352-43224374 ATCAGCCCAATCTAGATTGTGGG + Intergenic
954104472 3:48402522-48402544 TTCAGGCCCCTGCAGGTTTTAGG - Intergenic
955303759 3:57809426-57809448 CTCAGCCCACTCTGGACTTTGGG + Intronic
955758238 3:62249254-62249276 TTCAGGCCTCTCAAGGTGTTTGG - Intronic
957140502 3:76348789-76348811 TTCAGGGCAATTTAGATTTGTGG - Intronic
957850602 3:85801968-85801990 TTAAGGCCAGTGTAGATCTTAGG + Intronic
964278360 3:155033241-155033263 TTCAGGACACTCTAAATTTATGG - Intronic
965289875 3:166865320-166865342 CTCAGGCCCCTGCAGATTTTAGG + Intergenic
967262589 3:187658240-187658262 TGTAGGCCACTCTAGGGTTTAGG - Intergenic
970925146 4:21443267-21443289 TTCAGGCCATGCAAGATATTTGG - Intronic
971867289 4:32189534-32189556 TTCAGCCCCCTCCAGATTTTGGG + Intergenic
975498262 4:75057756-75057778 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
978663477 4:111154813-111154835 ATCAGCCCCCTCCAGATTTTGGG - Intergenic
980703097 4:136457615-136457637 TTCAGCCCCCTCCAGACTTTGGG + Intergenic
981837454 4:149071705-149071727 TTCAGGACACTTTAGAATCTGGG - Intergenic
982158110 4:152540764-152540786 TTCCGCCCCCTCTAGATGTTGGG - Intergenic
983715376 4:170776131-170776153 CTCAGCCCCCTCTAGACTTTGGG + Intergenic
983794283 4:171840791-171840813 TTCAGAAAAATCTAGATTTTAGG - Intronic
985281431 4:188290059-188290081 TTCAGGCCACTCCCCATTTTAGG + Intergenic
989425583 5:41291748-41291770 TTCAGGCCACTTTGTGTTTTTGG + Intergenic
990682292 5:58258695-58258717 TTCAACTCACTCAAGATTTTAGG - Intergenic
990923532 5:60994080-60994102 CTCAGCCCCCTCTGGATTTTGGG - Intronic
992068474 5:73128569-73128591 TTCAGGCCACACTAGTATTAAGG + Intronic
992930747 5:81642210-81642232 TTCAGGCCTATTTAGGTTTTTGG + Intronic
993784073 5:92107176-92107198 TCCAGGCCACTCTAAACTTAAGG - Intergenic
994406611 5:99352874-99352896 CTCAGGCCCCTCCAGACTTTGGG - Intergenic
995008614 5:107232079-107232101 CTCAGGACACATTAGATTTTTGG + Intergenic
995481636 5:112598982-112599004 TCCTGGCCACTCTAGGTTATAGG + Intergenic
998956660 5:147445744-147445766 GTTTGGCCAGTCTAGATTTTGGG + Intronic
998962578 5:147504408-147504430 TTCAGGCCACACTTGAATCTGGG - Intronic
998990396 5:147808985-147809007 CTCATGCCATTCTAGCTTTTTGG + Intergenic
999111782 5:149127682-149127704 TTCAGGAAAATTTAGATTTTAGG + Intergenic
1001129226 5:169049782-169049804 TTCTGCCCACTTTAGAGTTTAGG - Intronic
1001626604 5:173141064-173141086 TTCAGGTCACTCCAGTGTTTTGG - Intergenic
1004156845 6:13176987-13177009 TTCAGGACCCTCTGGAGTTTAGG - Intronic
1005103419 6:22198335-22198357 TTCAGGCCACTTTTGATCATGGG - Intergenic
1005206103 6:23406706-23406728 TACAGACCACTGTAGTTTTTAGG - Intergenic
1005498253 6:26407629-26407651 TACAGGCCTCTCAAGAATTTAGG + Intronic
1008574243 6:52844435-52844457 TTCAACTCACTCTGGATTTTAGG - Intronic
1008856492 6:56094566-56094588 CCCAAGCCACTCTACATTTTAGG + Intronic
1009610215 6:65931262-65931284 CTCAGTCCCCTCTAGATTTTGGG - Intergenic
1009705832 6:67251033-67251055 TTCAGTCCACGCTAGGTTTCAGG + Intergenic
1012052338 6:94361564-94361586 CTCAGCCCCCTCTGGATTTTGGG - Intergenic
1012351794 6:98260528-98260550 TTGGGGCCACTCAAGATTGTAGG - Intergenic
1012752727 6:103184052-103184074 TTCAGCCCTCTCCAGACTTTGGG + Intergenic
1014085488 6:117337977-117337999 TTCATTCCACTTTAGATATTGGG + Intronic
1014098697 6:117486528-117486550 CTCAGGCCTCTCTAGCTGTTTGG + Intronic
1014943640 6:127472310-127472332 TCCAGGCCACTTTAGGTTTGAGG + Intronic
1015452260 6:133384084-133384106 TTGAGGCTACTCAGGATTTTTGG + Intronic
1015719808 6:136229265-136229287 ATTAGGCCACTGCAGATTTTAGG + Intergenic
1015888376 6:137944401-137944423 TTCAGTACTCTTTAGATTTTAGG + Intergenic
1016092195 6:139993562-139993584 TTCAGACCAATCTAGAATTGAGG - Intergenic
1016210786 6:141531355-141531377 CTCAGGCCTCTCCAGACTTTGGG + Intergenic
1016575837 6:145568908-145568930 TTCAAGCCACTCTAGTTTGCTGG + Intronic
1016758912 6:147716212-147716234 TTCAGCCCCCTCTGGACTTTGGG - Intronic
1020959628 7:14786756-14786778 CTCAGCCCCCTCCAGATTTTGGG + Intronic
1021328726 7:19307853-19307875 AGCAGTCAACTCTAGATTTTAGG + Intergenic
1023485039 7:40677222-40677244 TTCGGCCAACTCTACATTTTAGG + Intronic
1024131393 7:46356172-46356194 TTCAGGCCACAAAAGATTCTTGG - Intergenic
1024466736 7:49719268-49719290 TTCTGGGGAATCTAGATTTTTGG - Intergenic
1027573966 7:79908213-79908235 TTAAGTCCACTCTTAATTTTTGG - Intergenic
1028218569 7:88166465-88166487 TTTGGGCCACCCTAGCTTTTAGG - Intronic
1029432564 7:100540405-100540427 TCCAGGAAACTCTAGATTTTGGG + Intronic
1029899250 7:104022260-104022282 CTCAGGCCCCTCCAGACTTTGGG + Intergenic
1030032865 7:105385591-105385613 CTCAGGCCACTCTTACTTTTGGG + Intronic
1030884916 7:114924563-114924585 TTCAGGCCACTCTAGATTTTCGG - Intronic
1032878889 7:136067378-136067400 TGTTGGCCACTCTAAATTTTAGG - Intergenic
1050918511 9:11168144-11168166 TAAAGGTCATTCTAGATTTTTGG + Intergenic
1051501620 9:17784380-17784402 TTCAGGCCATTTTACATTTAAGG - Intronic
1051696894 9:19777924-19777946 ATGAGGCCACTTTAAATTTTAGG - Intronic
1056979546 9:91296432-91296454 TTCAGGCAACTGAAGAATTTGGG - Intronic
1058579775 9:106442434-106442456 TTCATGTCACTCGAGATTTGTGG - Intergenic
1189768349 X:44395195-44395217 TTCAGCCCACTACACATTTTTGG - Intergenic
1190560939 X:51684448-51684470 TTCAGTCCACTCTCTACTTTTGG + Intergenic
1190563352 X:51708873-51708895 TTCAGTCCACTCTCTACTTTTGG - Intergenic
1190621053 X:52287572-52287594 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
1194310602 X:92301362-92301384 CTCAGGACACTCTAGACTTAGGG - Intronic
1200618884 Y:5415648-5415670 CTCAGGACACTCTAGACTTAGGG - Intronic