ID: 1030890859

View in Genome Browser
Species Human (GRCh38)
Location 7:114997262-114997284
Sequence GGTACATGGTTGAGTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030890859 Original CRISPR GGTACATGGTTGAGTGCTAT TGG Intronic
902359604 1:15935223-15935245 GGGACATGGTTGACTTCTGTAGG - Exonic
906380992 1:45332093-45332115 GGCACAGGGTTGAGTGTCATAGG + Intronic
908466413 1:64400434-64400456 GGTAAATAGTTATGTGCTATGGG - Intergenic
909648168 1:77940161-77940183 GGTACATGTTTAAGTGCTACAGG - Intronic
911900560 1:103497951-103497973 GGTACATGGTTGAGACCTTTAGG - Intergenic
913317998 1:117568386-117568408 GGTACATGGTGGAGGGATGTGGG - Intergenic
916079589 1:161224102-161224124 GGGACAGGGTTGAGGGCTATGGG + Intergenic
923764681 1:236882195-236882217 GGTCCATGGCTGAGTGCTGTGGG + Intronic
1074642580 10:115404097-115404119 GGTAAATGTTTGAGTTCTTTTGG + Intronic
1080422432 11:32122938-32122960 GGGACTTCGTTGAGTGCTGTGGG - Intergenic
1084459638 11:69289307-69289329 GGTACCTATTTCAGTGCTATAGG + Intergenic
1089476147 11:118764439-118764461 GGTACAAAGTTGTTTGCTATGGG - Intronic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1089690009 11:120181283-120181305 GGTACATGAGTGAGTGATCTGGG - Intronic
1091018644 11:132078408-132078430 GGTACCTGGGTGAGTGCCACCGG + Intronic
1095381899 12:41605018-41605040 AGTACATGGTTGACTTCTGTAGG + Intergenic
1095819134 12:46458195-46458217 GGTACATGGTAGGGTTCTGTTGG - Intergenic
1098412194 12:70198462-70198484 GATGCCTGGTTGAGTGTTATAGG - Intergenic
1098877026 12:75876557-75876579 GTTACATGGATGAGTTCTTTAGG - Intergenic
1101241832 12:102846852-102846874 GGTGGATGGTGGAGTGCTATAGG - Intronic
1101548629 12:105740696-105740718 GGTACATTGTTGAATGCTGGGGG + Intergenic
1104570148 12:129917944-129917966 GGGACATGGTTGACTGCCCTTGG - Intergenic
1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG + Intronic
1112238296 13:97656179-97656201 GGTTCCTGGTGGAGTGCCATAGG - Intergenic
1112624967 13:101093654-101093676 TGGACTAGGTTGAGTGCTATAGG + Intronic
1112733119 13:102388945-102388967 GGTACATGATTGGGAGTTATGGG - Intronic
1114909972 14:27179670-27179692 GGAACATGGTATAGTGCCATTGG - Intergenic
1119525889 14:75321913-75321935 GGTACATTGGTGAGGGCTCTGGG - Intergenic
1126916723 15:53474170-53474192 GGTACCTGGATTTGTGCTATGGG - Intergenic
1128767115 15:70257967-70257989 GGTTCAGGCTTGAGTGCTTTTGG + Intergenic
1129960046 15:79675884-79675906 GCTGCATAGTTGAGAGCTATTGG - Intergenic
1131410265 15:92201485-92201507 GGTACACGGTTGTGTGGGATGGG - Intergenic
1132405431 15:101539305-101539327 GGAACTTGGTTGTGTGCAATGGG - Intergenic
1139300764 16:65943509-65943531 GGCAGATGGTTGGGTGCTCTTGG - Intergenic
1140266519 16:73426036-73426058 GGCCCAAGGGTGAGTGCTATGGG - Intergenic
1141954819 16:87363662-87363684 GCTACATGGTTAAGTGCTACGGG + Intronic
1155921265 18:31605298-31605320 GGTACATGATTAAGTCCTTTAGG - Intergenic
1156343354 18:36233070-36233092 GGTACATGGGTAAGTTCTTTAGG + Intronic
1157585085 18:48795895-48795917 GGTACCTGGCTGAGAGCTGTGGG - Intronic
1162765298 19:12915731-12915753 GGTACAGGGGTGAGTGCAAGGGG - Intronic
925436618 2:3843584-3843606 GGTGAAAGGTTGATTGCTATGGG + Intronic
925834869 2:7934748-7934770 GGAACTTGGTTGGGTGCAATAGG + Intergenic
931817726 2:65921223-65921245 GGTCCAAGGGGGAGTGCTATGGG - Intergenic
933942879 2:87259844-87259866 TGAAGATGGCTGAGTGCTATGGG - Intergenic
936337336 2:111601718-111601740 TGAAGATGGCTGAGTGCTATGGG + Intergenic
940562277 2:155313626-155313648 GGTGAATAGTTGAGTGCGATGGG - Intergenic
944531522 2:200672682-200672704 GGTTGATGCTTGAGTGCTAAGGG + Intronic
945935220 2:215897031-215897053 GTTACATGGCTGAATGCTGTTGG - Intergenic
1173513396 20:43648066-43648088 TCTACATGGTTGTGTCCTATGGG - Intergenic
1174484250 20:50851402-50851424 GGTCTTTGGTGGAGTGCTATAGG + Intronic
1184799169 22:46749727-46749749 GATACATGGGAAAGTGCTATAGG - Intergenic
954297011 3:49679858-49679880 GGAACAGAGTTGAGTGCTAAAGG - Intronic
956205483 3:66750537-66750559 GTTACATGGATGAGTTCTTTAGG - Intergenic
956721682 3:72123623-72123645 GGAACATAGTTGAGTACTCTTGG + Intergenic
961971326 3:130971714-130971736 GGTACTTGGGGGAGTTCTATTGG - Intronic
965096838 3:164240261-164240283 GGTACATGGTTATGTGGCATGGG + Intergenic
972731609 4:41800500-41800522 AGTATATGGTTTAGTGGTATTGG - Intergenic
977003714 4:91537752-91537774 GGTATATTGTTGATTGCTATGGG - Intronic
978000564 4:103552876-103552898 GGCTCATGGTTGACTGCTTTGGG - Intergenic
979438747 4:120726051-120726073 GGCACAAGGTAGAGTGCTACAGG + Intronic
982628499 4:157800753-157800775 GTTACATGGATGAGTTCTTTAGG + Intergenic
994474942 5:100255410-100255432 AGCACATTGTTGTGTGCTATTGG - Intergenic
998737517 5:145159532-145159554 GGTACACGGTTAAGTGCTGAAGG + Intergenic
1000098725 5:157994247-157994269 GGCACATTGTTGAGGGCTGTGGG - Intergenic
1000527349 5:162374079-162374101 TTTACATGGTTGTGTGCTAAAGG - Intergenic
1004916211 6:20334500-20334522 GGTCCTTGGTTCATTGCTATTGG + Intergenic
1005926207 6:30447813-30447835 GGTACCTGGTAGAGTTATATGGG + Intergenic
1006803030 6:36771509-36771531 GGCCCATGGTTAAGTGCTATAGG + Intronic
1010464974 6:76157181-76157203 GTTACATGGTTAAGTTCTTTAGG + Intergenic
1015939200 6:138431748-138431770 GGCACAGGGGTGAGTGCTGTGGG + Exonic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1025014390 7:55427178-55427200 GGTACAAGGTTGAGAACTACTGG - Intronic
1030890859 7:114997262-114997284 GGTACATGGTTGAGTGCTATTGG + Intronic
1038256908 8:25958660-25958682 GGTTCCCTGTTGAGTGCTATTGG + Intronic
1039931645 8:41996413-41996435 AGTGCATGTTTGAGTGTTATAGG - Intronic
1042594875 8:70436499-70436521 GGTACATGGCTTACTGATATGGG - Intergenic
1050711525 9:8470852-8470874 GTTGGATGGTTCAGTGCTATGGG - Intronic
1052354704 9:27492571-27492593 GGTAAATGGTTAAATCCTATTGG - Intronic
1052381302 9:27773775-27773797 GGTATAAGGTAGAGTGCCATTGG - Intergenic
1056147025 9:83742258-83742280 GATACAGGGTTAAGTTCTATTGG + Intronic
1059706856 9:116832787-116832809 GGTATATGCATGAGGGCTATTGG + Intronic
1186501409 X:10053611-10053633 TGGACATGGTTGAGGGCTAGAGG + Intronic
1189919989 X:45894167-45894189 GTAACATAGTTGAGTGATATGGG - Intergenic
1195333430 X:103826035-103826057 GGAAAATGGCTGAGTGCCATGGG + Intronic
1199610601 X:149609703-149609725 GGAACATGGTTGGGTCCTACAGG - Intronic