ID: 1030895515

View in Genome Browser
Species Human (GRCh38)
Location 7:115054767-115054789
Sequence GAGCAGAGTCTACTATAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030895515_1030895518 18 Left 1030895515 7:115054767-115054789 CCTAACTATAGTAGACTCTGCTC No data
Right 1030895518 7:115054808-115054830 ACACTTTCATTGCAGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030895515 Original CRISPR GAGCAGAGTCTACTATAGTT AGG (reversed) Intergenic
No off target data available for this crispr