ID: 1030895518

View in Genome Browser
Species Human (GRCh38)
Location 7:115054808-115054830
Sequence ACACTTTCATTGCAGTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030895516_1030895518 -7 Left 1030895516 7:115054792-115054814 CCTCAACAAGCCATTCACACTTT No data
Right 1030895518 7:115054808-115054830 ACACTTTCATTGCAGTACCTTGG No data
1030895514_1030895518 26 Left 1030895514 7:115054759-115054781 CCTGCTTTCCTAACTATAGTAGA No data
Right 1030895518 7:115054808-115054830 ACACTTTCATTGCAGTACCTTGG No data
1030895515_1030895518 18 Left 1030895515 7:115054767-115054789 CCTAACTATAGTAGACTCTGCTC No data
Right 1030895518 7:115054808-115054830 ACACTTTCATTGCAGTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030895518 Original CRISPR ACACTTTCATTGCAGTACCT TGG Intergenic
No off target data available for this crispr