ID: 1030906506

View in Genome Browser
Species Human (GRCh38)
Location 7:115190037-115190059
Sequence GGCCTTTTTACCTGACTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030906506_1030906509 10 Left 1030906506 7:115190037-115190059 CCTTGAAGTCAGGTAAAAAGGCC No data
Right 1030906509 7:115190070-115190092 AACTCACATTGTCTACATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030906506 Original CRISPR GGCCTTTTTACCTGACTTCA AGG (reversed) Intergenic
No off target data available for this crispr