ID: 1030907700

View in Genome Browser
Species Human (GRCh38)
Location 7:115206844-115206866
Sequence GACCCTTGACCCAGCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030907691_1030907700 21 Left 1030907691 7:115206800-115206822 CCTGAGACTCAGGGCACCATGTC No data
Right 1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG No data
1030907698_1030907700 -10 Left 1030907698 7:115206831-115206853 CCTAGAGCAGGGGGACCCTTGAC No data
Right 1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG No data
1030907696_1030907700 -1 Left 1030907696 7:115206822-115206844 CCTGAGTTGCCTAGAGCAGGGGG No data
Right 1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG No data
1030907692_1030907700 5 Left 1030907692 7:115206816-115206838 CCATGTCCTGAGTTGCCTAGAGC No data
Right 1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030907700 Original CRISPR GACCCTTGACCCAGCCCTGG AGG Intergenic
No off target data available for this crispr