ID: 1030907857

View in Genome Browser
Species Human (GRCh38)
Location 7:115208783-115208805
Sequence TGAAATCTTAAGAGAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030907854_1030907857 -10 Left 1030907854 7:115208770-115208792 CCCTTTTCCAGCATGAAATCTTA No data
Right 1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG No data
1030907853_1030907857 -7 Left 1030907853 7:115208767-115208789 CCTCCCTTTTCCAGCATGAAATC No data
Right 1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030907857 Original CRISPR TGAAATCTTAAGAGAGATGA AGG Intergenic
No off target data available for this crispr