ID: 1030908738

View in Genome Browser
Species Human (GRCh38)
Location 7:115220077-115220099
Sequence TTCCAAGGACACTCAACTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030908735_1030908738 -4 Left 1030908735 7:115220058-115220080 CCCAGGTCATGCAATTTGCTTCC No data
Right 1030908738 7:115220077-115220099 TTCCAAGGACACTCAACTAGTGG No data
1030908736_1030908738 -5 Left 1030908736 7:115220059-115220081 CCAGGTCATGCAATTTGCTTCCA No data
Right 1030908738 7:115220077-115220099 TTCCAAGGACACTCAACTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030908738 Original CRISPR TTCCAAGGACACTCAACTAG TGG Intergenic
No off target data available for this crispr