ID: 1030912639

View in Genome Browser
Species Human (GRCh38)
Location 7:115270927-115270949
Sequence GACACCCCACTGACCAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030912639_1030912642 16 Left 1030912639 7:115270927-115270949 CCAGCTCTGGTCAGTGGGGTGTC No data
Right 1030912642 7:115270966-115270988 TACTTTTCTCAGAAGAGGACTGG No data
1030912639_1030912643 17 Left 1030912639 7:115270927-115270949 CCAGCTCTGGTCAGTGGGGTGTC No data
Right 1030912643 7:115270967-115270989 ACTTTTCTCAGAAGAGGACTGGG No data
1030912639_1030912641 11 Left 1030912639 7:115270927-115270949 CCAGCTCTGGTCAGTGGGGTGTC No data
Right 1030912641 7:115270961-115270983 GAGGCTACTTTTCTCAGAAGAGG No data
1030912639_1030912640 -8 Left 1030912639 7:115270927-115270949 CCAGCTCTGGTCAGTGGGGTGTC No data
Right 1030912640 7:115270942-115270964 GGGGTGTCGTCTTACATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030912639 Original CRISPR GACACCCCACTGACCAGAGC TGG (reversed) Intergenic
No off target data available for this crispr