ID: 1030913954

View in Genome Browser
Species Human (GRCh38)
Location 7:115289218-115289240
Sequence TTGGTTTAGCACCATCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030913954_1030913960 20 Left 1030913954 7:115289218-115289240 CCAAGAGGATGGTGCTAAACCAA No data
Right 1030913960 7:115289261-115289283 TGATCCAATCACCTCCCACAAGG 0: 62
1: 2307
2: 5167
3: 9446
4: 11700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030913954 Original CRISPR TTGGTTTAGCACCATCCTCT TGG (reversed) Intergenic
No off target data available for this crispr