ID: 1030920908

View in Genome Browser
Species Human (GRCh38)
Location 7:115385267-115385289
Sequence CAAACGTTCTTAAAGTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030920904_1030920908 -9 Left 1030920904 7:115385253-115385275 CCAGTTCTTGTCCCCAAACGTTC No data
Right 1030920908 7:115385267-115385289 CAAACGTTCTTAAAGTCTCTTGG No data
1030920903_1030920908 9 Left 1030920903 7:115385235-115385257 CCTTTAAAAGCAATGCTACCAGT No data
Right 1030920908 7:115385267-115385289 CAAACGTTCTTAAAGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030920908 Original CRISPR CAAACGTTCTTAAAGTCTCT TGG Intergenic
No off target data available for this crispr