ID: 1030921285

View in Genome Browser
Species Human (GRCh38)
Location 7:115391772-115391794
Sequence AAAAATTGGGAGAAGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030921285_1030921291 10 Left 1030921285 7:115391772-115391794 CCCGCCTCCTTCTCCCAATTTTT No data
Right 1030921291 7:115391805-115391827 TACTTAATGCATGCCTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030921285 Original CRISPR AAAAATTGGGAGAAGGAGGC GGG (reversed) Intergenic
No off target data available for this crispr