ID: 1030922710

View in Genome Browser
Species Human (GRCh38)
Location 7:115412067-115412089
Sequence AGTCACATCTTTCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030922710_1030922712 14 Left 1030922710 7:115412067-115412089 CCTTCCTGTGGAAAGATGTGACT No data
Right 1030922712 7:115412104-115412126 CACTTCAGCTTACGTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030922710 Original CRISPR AGTCACATCTTTCCACAGGA AGG (reversed) Intergenic
No off target data available for this crispr