ID: 1030924378

View in Genome Browser
Species Human (GRCh38)
Location 7:115433367-115433389
Sequence GTTTCTGTCTTTCCTGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030924374_1030924378 24 Left 1030924374 7:115433320-115433342 CCTGCTCAGGGAGGGTATGAACT No data
Right 1030924378 7:115433367-115433389 GTTTCTGTCTTTCCTGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030924378 Original CRISPR GTTTCTGTCTTTCCTGGATC TGG Intergenic
No off target data available for this crispr