ID: 1030925630

View in Genome Browser
Species Human (GRCh38)
Location 7:115450309-115450331
Sequence CTTAACATGGAGGCAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030925630_1030925635 30 Left 1030925630 7:115450309-115450331 CCCTCCATTGCCTCCATGTTAAG No data
Right 1030925635 7:115450362-115450384 TCTCAAGATGTACAAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030925630 Original CRISPR CTTAACATGGAGGCAATGGA GGG (reversed) Intergenic
No off target data available for this crispr