ID: 1030928877

View in Genome Browser
Species Human (GRCh38)
Location 7:115497175-115497197
Sequence TGGGTGGCCCAGGCATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030928867_1030928877 28 Left 1030928867 7:115497124-115497146 CCTTGAAAGTTTCCAGCAGAAAC No data
Right 1030928877 7:115497175-115497197 TGGGTGGCCCAGGCATGTCTGGG No data
1030928869_1030928877 16 Left 1030928869 7:115497136-115497158 CCAGCAGAAACAATGGCATTAAG No data
Right 1030928877 7:115497175-115497197 TGGGTGGCCCAGGCATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030928877 Original CRISPR TGGGTGGCCCAGGCATGTCT GGG Intergenic
No off target data available for this crispr