ID: 1030930976

View in Genome Browser
Species Human (GRCh38)
Location 7:115523157-115523179
Sequence GCTGCAAGCAAATTTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030930976_1030930977 9 Left 1030930976 7:115523157-115523179 CCTGCTTTAAATTTGCTTGCAGC No data
Right 1030930977 7:115523189-115523211 TCTGCCCACCAGATTAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030930976 Original CRISPR GCTGCAAGCAAATTTAAAGC AGG (reversed) Intergenic
No off target data available for this crispr