ID: 1030931292

View in Genome Browser
Species Human (GRCh38)
Location 7:115525712-115525734
Sequence AGTTATCTGCGGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030931289_1030931292 4 Left 1030931289 7:115525685-115525707 CCAAGAGCTGTCTCTCAAAAGGC No data
Right 1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG No data
1030931286_1030931292 16 Left 1030931286 7:115525673-115525695 CCCTGTAATGGGCCAAGAGCTGT No data
Right 1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG No data
1030931287_1030931292 15 Left 1030931287 7:115525674-115525696 CCTGTAATGGGCCAAGAGCTGTC 0: 6
1: 25
2: 183
3: 198
4: 237
Right 1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG No data
1030931284_1030931292 25 Left 1030931284 7:115525664-115525686 CCACCAAAGCCCTGTAATGGGCC No data
Right 1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG No data
1030931285_1030931292 22 Left 1030931285 7:115525667-115525689 CCAAAGCCCTGTAATGGGCCAAG No data
Right 1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030931292 Original CRISPR AGTTATCTGCGGAAGATGGC AGG Intergenic
No off target data available for this crispr