ID: 1030934746

View in Genome Browser
Species Human (GRCh38)
Location 7:115571538-115571560
Sequence AGGGTTATACATTAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1030934746_1030934754 11 Left 1030934746 7:115571538-115571560 CCTTCCTCCTAATGTATAACCCT No data
Right 1030934754 7:115571572-115571594 CCTTTCTCCAGGATAGAAAATGG No data
1030934746_1030934751 0 Left 1030934746 7:115571538-115571560 CCTTCCTCCTAATGTATAACCCT No data
Right 1030934751 7:115571561-115571583 CTAAATGTCCTCCTTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1030934746 Original CRISPR AGGGTTATACATTAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr